Construct: ORF TRCN0000478096
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018183.1_s317c1
- Derived from:
- ccsbBroadEn_10545
- DNA Barcode:
- GGTAGCAGCATCTGGTAAAACCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HMGB3P1 (128872)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478096
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3149 | HMGB3 | high mobility group box 3 | NM_001301228.1 | 60.6% | 57% | (many diffs) |
2 | human | 3149 | HMGB3 | high mobility group box 3 | NM_001301229.2 | 60.6% | 57% | (many diffs) |
3 | human | 3149 | HMGB3 | high mobility group box 3 | NM_005342.4 | 60.6% | 57% | (many diffs) |
4 | human | 3149 | HMGB3 | high mobility group box 3 | XM_024452369.1 | 60.6% | 57% | (many diffs) |
5 | human | 3149 | HMGB3 | high mobility group box 3 | NM_001301231.2 | 55.1% | 51.8% | (many diffs) |
6 | human | 128872 | HMGB3P1 | high mobility group box 3 p... | NR_002165.1 | 43.9% | 1_495del;886_888delTAA | |
7 | mouse | 15354 | Hmgb3 | high mobility group box 3 | NM_001293623.1 | 57.5% | 56% | (many diffs) |
8 | mouse | 15354 | Hmgb3 | high mobility group box 3 | NM_001293624.1 | 57.5% | 56% | (many diffs) |
9 | mouse | 15354 | Hmgb3 | high mobility group box 3 | NM_001293625.1 | 57.5% | 56% | (many diffs) |
10 | mouse | 15354 | Hmgb3 | high mobility group box 3 | NM_008253.4 | 57.5% | 56% | (many diffs) |
11 | mouse | 15354 | Hmgb3 | high mobility group box 3 | XM_006527842.3 | 57.5% | 56% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 459
- ORF length:
- 390
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcaaaggcg gataaagtgc actgtgatag agaaatgaag gattatggac 121 cagctaaggg aggcaagaac gatcctaatg cccccaaaag gccactgtct ggattcttcc 181 tgttctgttc agaattctgc cccaagatca aatccacaaa ccctggcatc tctattggag 241 acgtggcaaa aaagCTGGGT GAGATGTGGA ATAACTTAAA TGACAGTGAA AAGCAGCCTT 301 ATGTCACTAA GGTGGCAAAG CTGAAGAAGT ATGAGAAGGA TGTTGCTGAC TATAAGTCGA 361 AAGGAAAGTT GGACGGCACA AAAGGTCCTG CTAAAGTTGC CTGGGAAAAG ATGGAAGAAG 421 AAGATGAAGA AGATGGGGAG GAAGAGAAGG AGGATGAATT GCCAACTTTC TTGTACAAAG 481 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 541 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 601 ACGAGGTAGC AGCATCTGGT AAAACCTGAC GCGTTAAGTC gacaatcaac ctctggatta 661 caaaatttgt gaaagatt