Transcript: Human NM_001301229.2

Homo sapiens high mobility group box 3 (HMGB3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
HMGB3 (3149)
Length:
3503
CDS:
44..646

Additional Resources:

NCBI RefSeq record:
NM_001301229.2
NBCI Gene record:
HMGB3 (3149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018519 GCAGATAAAGTGCGCTATGAT pLKO.1 239 CDS 100% 5.625 7.875 N HMGB3 n/a
2 TRCN0000018518 GCCGTAATTGACACATCTCTT pLKO.1 693 3UTR 100% 4.950 6.930 N HMGB3 n/a
3 TRCN0000419755 GACATGCAGAGAAGAACATAA pLKO_005 106 CDS 100% 13.200 9.240 N HMGB3 n/a
4 TRCN0000420885 TGTTGCCCTCATTAGGTTTAA pLKO_005 728 3UTR 100% 13.200 9.240 N HMGB3 n/a
5 TRCN0000422073 CTAGAAATTGTCAGTGGTTTA pLKO_005 793 3UTR 100% 10.800 7.560 N HMGB3 n/a
6 TRCN0000071432 CCTGCTAAAGTTGCCCGGAAA pLKO.1 557 CDS 100% 4.050 2.835 N Hmgb3 n/a
7 TRCN0000430408 CCCAGAGGTCCCTGTCAATTT pLKO_005 136 CDS 100% 13.200 7.920 N HMGB3 n/a
8 TRCN0000423978 AGAAGAAGAAGGATCCTAATG pLKO_005 297 CDS 100% 10.800 6.480 N HMGB3 n/a
9 TRCN0000018520 GCAAAGCTGAAGGAGAAGTAT pLKO.1 482 CDS 100% 5.625 3.375 N HMGB3 n/a
10 TRCN0000186551 GCAGAGAAGAACATAAGAAGA pLKO.1 111 CDS 100% 4.950 2.970 N HMGB3P27 n/a
11 TRCN0000071431 GAAGGATGTTGCTGACTATAA pLKO.1 505 CDS 100% 13.200 6.600 Y Hmgb3 n/a
12 TRCN0000428612 GAAGGATGTTGCTGACTATAA pLKO_005 505 CDS 100% 13.200 6.600 Y HMGB3 n/a
13 TRCN0000016705 GCTGGGTGAGATGTGGAATAA pLKO.1 421 CDS 100% 13.200 6.600 Y HMGB3P1 n/a
14 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 599 CDS 100% 4.950 2.475 Y PTMA n/a
15 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 609 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00752 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00752 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_10545 pDONR223 100% 60.6% 57% None (many diffs) n/a
4 ccsbBroad304_10545 pLX_304 0% 60.6% 57% V5 (many diffs) n/a
5 TRCN0000478096 GGTAGCAGCATCTGGTAAAACCTG pLX_317 52% 60.6% 57% V5 (many diffs) n/a
6 ccsbBroadEn_10544 pDONR223 100% 60.5% 57% None (many diffs) n/a
7 ccsbBroad304_10544 pLX_304 0% 60.5% 57% V5 (many diffs) n/a
Download CSV