Construct: ORF TRCN0000478185
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000779.3_s317c1
- Derived from:
- ccsbBroadEn_05979
- DNA Barcode:
- TGCATTGATTCACATCGACTACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK9 (1025)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478185
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1025 | CDK9 | cyclin dependent kinase 9 | NM_001261.4 | 99.9% | 100% | 6A>G |
| 2 | mouse | 107951 | Cdk9 | cyclin-dependent kinase 9 (... | NM_130860.3 | 89.2% | 98.6% | (many diffs) |
| 3 | mouse | 107951 | Cdk9 | cyclin-dependent kinase 9 (... | XM_011239001.1 | 59% | 64.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1182
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaagcagtac gactcggtgg agtgcccttt ttgtgatgaa gtttccaaat 121 acgagaagct cgccaagatc ggccaaggca ccttcgggga ggtgttcaag gccaggcacc 181 gcaagaccgg ccagaaggtg gctctgaaga aggtgctgat ggaaaacgag aaggaggggt 241 tccccattac agccttgcgg gagatcaaga tccttcagct tctaaaacac gagaatgtgg 301 tcaacttgat tgagatttgt cgaaccaaag cttcccccta taaccgctgc aagggtagta 361 tatacctggt gttcgacttc tgcgagcatg accttgctgg gctgttgagc aatgttttgg 421 tcaagttcac gctgtctgag atcaagaggg tgatgcagat gctgcttaac ggcctctact 481 acatccacag aaacaagatc ctgcataggg acatgaaggc tgctaatgtg cttatcactc 541 gtgatggggt cctgaagctg gcagactttg ggctggcccg ggccttcagc ctggccaaga 601 acagccagcc caaccgctac accaaccgtg tggtgacact ctggtaccgg cccccggagc 661 tgttgctcgg ggagcgggac tacggccccc ccattgacct gtggggtgct gggtgcatca 721 tggcagagat gtggacccgc agccccatca tgcagggcaa cacggagcag caccaactcg 781 ccctcatcag tcagctctgc ggctccatca cccctgaggt gtggccaaac gtggacaact 841 atgagctgta cgaaaagctg gagctggtca agggccagaa gcggaaggtg aaggacaggc 901 tgaaggccta tgtgcgtgac ccatacgcac tggacctcat cgacaagctg ctggtgctgg 961 accctgccca gcgcatcgac agcgatgacg ccctcaacca cgacttcTTC TGGTCCGACC 1021 CCATGCCCTC CGACCTCAAG GGCATGCTCT CCACCCACCT GACGTCCATG TTCGAGTACT 1081 TGGCACCACC GCGCCGGAAG GGCAGCCAGA TCACCCAGCA GTCCACCAAC CAGAGTCGCA 1141 ATCCCGCCAC CACCAACCAG ACGGAGTTTG AGCGCGTCTT CTGCCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGATGC ATTGATTCAC ATCGACTACT CACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t