Transcript: Human NM_001261.4

Homo sapiens cyclin dependent kinase 9 (CDK9), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CDK9 (1025)
Length:
2483
CDS:
116..1234

Additional Resources:

NCBI RefSeq record:
NM_001261.4
NBCI Gene record:
CDK9 (1025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162576 CCAGAGTGTCACCACACGGT pXPR_003 TGG 562 50% 5 0.706 CDK9 CDK9 77170
2 BRDN0001146478 GCTGACTGATGAGGGCGAGT pXPR_003 TGG 713 64% 6 0.6966 CDK9 CDK9 77169
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000496 CCGCTGCAAGGGTAGTATATA pLKO.1 394 CDS 100% 15.000 21.000 N CDK9 n/a
2 TRCN0000199892 GTTCGACTTCTGCGAGCATGA pLKO.1 421 CDS 100% 4.050 5.670 N CDK9 n/a
3 TRCN0000196455 GAAGTTTCCAAATACGAGAAG pLKO.1 158 CDS 100% 4.050 3.240 N CDK9 n/a
4 TRCN0000000495 AGGGACATGAAGGCTGCTAAT pLKO.1 557 CDS 100% 10.800 7.560 N CDK9 n/a
5 TRCN0000342324 AGGGACATGAAGGCTGCTAAT pLKO_005 557 CDS 100% 10.800 7.560 N CDK9 n/a
6 TRCN0000000497 CTACTACATCCACAGAAACAA pLKO.1 526 CDS 100% 5.625 3.938 N CDK9 n/a
7 TRCN0000342323 CTACTACATCCACAGAAACAA pLKO_005 526 CDS 100% 5.625 3.938 N CDK9 n/a
8 TRCN0000000494 GCACAGTTTGGTCCGTTAGAA pLKO.1 1729 3UTR 100% 5.625 3.938 N CDK9 n/a
9 TRCN0000342251 GCACAGTTTGGTCCGTTAGAA pLKO_005 1729 3UTR 100% 5.625 3.938 N CDK9 n/a
10 TRCN0000199857 GCTGGGCTGTTGAGCAATGTT pLKO.1 446 CDS 100% 5.625 3.938 N CDK9 n/a
11 TRCN0000199187 CCAAACGTGGACAACTATGAG pLKO.1 875 CDS 100% 4.950 3.465 N CDK9 n/a
12 TRCN0000342325 CCAAACGTGGACAACTATGAG pLKO_005 875 CDS 100% 4.950 3.465 N CDK9 n/a
13 TRCN0000199780 GACGTCCATGTTCGAGTACTT pLKO.1 1111 CDS 100% 4.950 3.465 N CDK9 n/a
14 TRCN0000000498 TGATTGAGATTTGTCGAACCA pLKO.1 357 CDS 100% 2.640 1.848 N CDK9 n/a
15 TRCN0000199314 CTATGTGACTTGCATCGTGGA pLKO.1 1279 3UTR 100% 2.160 1.512 N CDK9 n/a
16 TRCN0000199660 GCACTGGACCTCATCGACAAG pLKO.1 977 CDS 100% 1.350 0.945 N CDK9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488759 AAACCGCGAGCGCTGCGTGCCTTT pLX_317 33.1% 99.9% 99.7% V5 1116_1117insG n/a
2 ccsbBroadEn_05979 pDONR223 100% 99.9% 100% None 6A>G n/a
3 ccsbBroad304_05979 pLX_304 0% 99.9% 100% V5 6A>G n/a
4 TRCN0000478185 TGCATTGATTCACATCGACTACTC pLX_317 16.2% 99.9% 100% V5 6A>G n/a
5 ccsbBroadEn_14579 pDONR223 0% 99.9% 100% None 6A>G n/a
6 ccsbBroad304_14579 pLX_304 0% 99.9% 100% V5 6A>G n/a
7 TRCN0000466715 CGACTTCTGTAATATGTGCTCATC pLX_317 33.2% 99.9% 100% V5 6A>G n/a
8 TRCN0000488358 AATTGCCAATATTTTACCTCCTTA pLX_317 28% 99.9% 100% V5 (not translated due to prior stop codon) 6A>G n/a
Download CSV