Transcript: Mouse NM_130860.3

Mus musculus cyclin-dependent kinase 9 (CDC2-related kinase) (Cdk9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cdk9 (107951)
Length:
3389
CDS:
129..1247

Additional Resources:

NCBI RefSeq record:
NM_130860.3
NBCI Gene record:
Cdk9 (107951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130860.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363369 GCTGAACGGCCTCTACTACAT pLKO_005 527 CDS 100% 4.950 6.930 N Cdk9 n/a
2 TRCN0000023232 GTACGAGAAACTTGCCAAGAT pLKO.1 182 CDS 100% 4.950 6.930 N Cdk9 n/a
3 TRCN0000023231 GTAGACAAGTATGAGCTGTTT pLKO.1 894 CDS 100% 4.950 6.930 N Cdk9 n/a
4 TRCN0000378650 GTGGCCAAACGTAGACAAGTA pLKO_005 884 CDS 100% 4.950 6.930 N Cdk9 n/a
5 TRCN0000023229 CGTCTTAGTCAAGTTCACGTT pLKO.1 476 CDS 100% 2.640 3.696 N Cdk9 n/a
6 TRCN0000363367 CCTTCAGCCTAGCTAAGAATA pLKO_005 646 CDS 100% 13.200 9.240 N Cdk9 n/a
7 TRCN0000361918 GAAGGTGAAGGACCGTCTGAA pLKO_005 947 CDS 100% 4.950 3.465 N Cdk9 n/a
8 TRCN0000361919 TCTGAGATCAAGAGAGTGATG pLKO_005 498 CDS 100% 4.050 2.835 N Cdk9 n/a
9 TRCN0000023230 CATGAGAATGTGGTGAACCTA pLKO.1 351 CDS 100% 3.000 2.100 N Cdk9 n/a
10 TRCN0000361916 CCTATGCTCTGGACCTCATTG pLKO_005 985 CDS 100% 10.800 6.480 N Cdk9 n/a
11 TRCN0000023233 CGGAATTTGAACGTGTCTTCT pLKO.1 1225 CDS 100% 4.950 2.970 N Cdk9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130860.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05979 pDONR223 100% 89.2% 98.6% None (many diffs) n/a
2 ccsbBroad304_05979 pLX_304 0% 89.2% 98.6% V5 (many diffs) n/a
3 TRCN0000478185 TGCATTGATTCACATCGACTACTC pLX_317 16.2% 89.2% 98.6% V5 (many diffs) n/a
4 ccsbBroadEn_14579 pDONR223 0% 89.2% 98.6% None (many diffs) n/a
5 ccsbBroad304_14579 pLX_304 0% 89.2% 98.6% V5 (many diffs) n/a
6 TRCN0000466715 CGACTTCTGTAATATGTGCTCATC pLX_317 33.2% 89.2% 98.6% V5 (many diffs) n/a
7 TRCN0000488358 AATTGCCAATATTTTACCTCCTTA pLX_317 28% 89.2% 98.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488759 AAACCGCGAGCGCTGCGTGCCTTT pLX_317 33.1% 89.1% 98.3% V5 (many diffs) n/a
Download CSV