Construct: ORF TRCN0000478236
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014939.4_s317c1
- Derived from:
- ccsbBroadEn_05796
- DNA Barcode:
- ATGACCTTTCTAGTCTATGTGTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AK1 (203)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478236
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 203 | AK1 | adenylate kinase 1 | NM_000476.2 | 99.6% | 98.9% | 27G>T;155C>T |
| 2 | human | 203 | AK1 | adenylate kinase 1 | NM_001318121.1 | 99.6% | 98.9% | 27G>T;155C>T |
| 3 | human | 203 | AK1 | adenylate kinase 1 | XM_017014428.1 | 99.4% | 98.9% | 27G>T;155C>T;477T>C |
| 4 | human | 203 | AK1 | adenylate kinase 1 | XM_024447439.1 | 92.5% | 92.7% | (many diffs) |
| 5 | human | 203 | AK1 | adenylate kinase 1 | NM_001318122.2 | 91.7% | 90.4% | (many diffs) |
| 6 | human | 203 | AK1 | adenylate kinase 1 | XM_024447440.1 | 68.9% | 69% | 0_1ins180;297T>C |
| 7 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198790.1 | 85.7% | 88.1% | (many diffs) |
| 8 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198791.1 | 85.7% | 88.1% | (many diffs) |
| 9 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198792.1 | 85.7% | 88.1% | (many diffs) |
| 10 | mouse | 11636 | Ak1 | adenylate kinase 1 | XM_006497624.3 | 85.7% | 88.1% | (many diffs) |
| 11 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_021515.3 | 78.7% | 80.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 648
- ORF length:
- 582
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agagaagctg aagaaaacca atatcatctt tgtggtgggt gggcctggct 121 cagggaaggg cacccagtgt gagaagatcg tgcagaagta tggctacacc cacctctcca 181 ccggggacct cctgcggtcc gaggtcagct caggctcggt caggggcaag aagctgtcgg 241 aaatcatgga gaaggggcag ctggttccac tggagacagt gttggacatg ctccgggatg 301 ccatggtggc caaagtcaat acttccaaag gcttccTGAT TGATGGCTAC CCGCGGGAGG 361 TGCAGCAAGG AGAAGAGTTT GAGCGACGGA TTGGACAGCC CACACTGCTG CTGTATGTGG 421 ACGCAGGCCC TGAGACCATG ACCCAGCGGC TCTTGAAACG TGGAGAGACC AGCGGGCGTG 481 TGGACGACAA TGAGGAGACC ATCAAAAAGC GGCTGGAGAC CTATTACAAG GCCACAGAAC 541 CCGTCATCGC CTTCTATGAG AAACGTGGCA TTGTGCGCAA GGTCAACGCT GAGGGCTCCG 601 TGGACAGTGT CTTCTCCCAG GTCTGCACCC ACCTGGACGC CCTAAAGTAC CCAACTTTCT 661 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 721 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 781 GTGGAAAGGA CGAATGACCT TTCTAGTCTA TGTGTAGACG CGTTAAGTCg acaatcaacc 841 tctggattac aaaatttgtg aaagatt