Transcript: Mouse NM_001198792.1

Mus musculus adenylate kinase 1 (Ak1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ak1 (11636)
Length:
2047
CDS:
93..677

Additional Resources:

NCBI RefSeq record:
NM_001198792.1
NBCI Gene record:
Ak1 (11636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024952 GCGGCTGGAGACTTATTACAA pLKO.1 536 CDS 100% 5.625 4.500 N Ak1 n/a
2 TRCN0000274549 GCGGCTGGAGACTTATTACAA pLKO_005 536 CDS 100% 5.625 4.500 N Ak1 n/a
3 TRCN0000024953 ACTTATTACAATGCCACAGAA pLKO.1 546 CDS 100% 4.950 3.960 N Ak1 n/a
4 TRCN0000024949 CGAGATGCTATGTTAGCCAAA pLKO.1 321 CDS 100% 4.050 3.240 N Ak1 n/a
5 TRCN0000274497 ATCTTGACTCCCTGAAGTAAC pLKO_005 658 CDS 100% 10.800 7.560 N Ak1 n/a
6 TRCN0000285239 TCTATGACAAGCGTGGCATTG pLKO_005 580 CDS 100% 6.000 4.200 N Ak1 n/a
7 TRCN0000024951 GAGGTGAAACAGGGAGAAGAA pLKO.1 384 CDS 100% 4.950 3.465 N Ak1 n/a
8 TRCN0000285242 GAGGTGAAACAGGGAGAAGAA pLKO_005 384 CDS 100% 4.950 3.465 N Ak1 n/a
9 TRCN0000024950 GCTGAAGAAGGCCAAGATCAT pLKO.1 104 CDS 100% 4.950 3.465 N Ak1 n/a
10 TRCN0000274496 TCCTGTCCCATGGACACTAAA pLKO_005 797 3UTR 100% 13.200 7.920 N Ak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488356 AGCCGCGCACGTTGCGCCCGGAAC pLX_317 53.1% 85.9% 88.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488309 TCCGTCCCTAGTTCAGGTATAAAT pLX_317 52.7% 85.7% 88.2% V5 (many diffs) n/a
3 ccsbBroadEn_05796 pDONR223 100% 85.7% 88.1% None (many diffs) n/a
4 ccsbBroad304_05796 pLX_304 0% 85.7% 88.1% V5 (many diffs) n/a
5 TRCN0000478236 ATGACCTTTCTAGTCTATGTGTAG pLX_317 53.4% 85.7% 88.1% V5 (many diffs) n/a
6 ccsbBroadEn_14535 pDONR223 0% 85.7% 88.1% None (many diffs) n/a
7 ccsbBroad304_14535 pLX_304 0% 85.7% 88.1% V5 (many diffs) n/a
8 TRCN0000471246 ATAAGACCGAGATCACACCTGAGG pLX_317 53.4% 85.7% 88.1% V5 (many diffs) n/a
9 TRCN0000488843 GAACCTGCCAACTGGCAGTAGAAC pLX_317 53.4% 85.3% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV