Transcript: Human XM_017014428.1

PREDICTED: Homo sapiens adenylate kinase 1 (AK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AK1 (203)
Length:
1254
CDS:
501..1085

Additional Resources:

NCBI RefSeq record:
XM_017014428.1
NBCI Gene record:
AK1 (203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195318 CGACAATGAGGAGACCATCAA pLKO.1 920 CDS 100% 4.950 3.465 N AK1 n/a
2 TRCN0000220619 GCCAAAGTCAATACTTCCAAA pLKO.1 744 CDS 100% 4.950 3.465 N AK1 n/a
3 TRCN0000199026 CGTGCAGAAGTATGGCTACAC pLKO.1 584 CDS 100% 4.050 2.835 N AK1 n/a
4 TRCN0000220620 GAAGAGTTTGAGCGACGGATT pLKO.1 807 CDS 100% 4.050 2.835 N AK1 n/a
5 TRCN0000220621 CTTCTATGAGAAACGTGGCAT pLKO.1 986 CDS 100% 2.640 1.848 N AK1 n/a
6 TRCN0000220618 GCTGTCGGAAATCATGGAGAA pLKO.1 668 CDS 100% 4.050 2.430 N AK1 n/a
7 TRCN0000342694 GCTGTCGGAAATCATGGAGAA pLKO_005 668 CDS 100% 4.050 2.430 N AK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488356 AGCCGCGCACGTTGCGCCCGGAAC pLX_317 53.1% 99.8% 100% V5 (not translated due to prior stop codon) 477T>C n/a
2 TRCN0000488309 TCCGTCCCTAGTTCAGGTATAAAT pLX_317 52.7% 99.6% 99.4% V5 477T>C;582_583insG n/a
3 ccsbBroadEn_14535 pDONR223 0% 99.6% 99.4% None 27G>T;477T>C n/a
4 ccsbBroad304_14535 pLX_304 0% 99.6% 99.4% V5 27G>T;477T>C n/a
5 TRCN0000471246 ATAAGACCGAGATCACACCTGAGG pLX_317 53.4% 99.6% 99.4% V5 27G>T;477T>C n/a
6 ccsbBroadEn_05796 pDONR223 100% 99.4% 98.9% None 27G>T;155C>T;477T>C n/a
7 ccsbBroad304_05796 pLX_304 0% 99.4% 98.9% V5 27G>T;155C>T;477T>C n/a
8 TRCN0000478236 ATGACCTTTCTAGTCTATGTGTAG pLX_317 53.4% 99.4% 98.9% V5 27G>T;155C>T;477T>C n/a
9 TRCN0000488843 GAACCTGCCAACTGGCAGTAGAAC pLX_317 53.4% 98.8% 98.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV