Construct: ORF TRCN0000478251
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010100.1_s317c1
- Derived from:
- ccsbBroadEn_13614
- DNA Barcode:
- GCAGCAGCCCAGATTTAGGCCAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SERINC2 (347735)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478251
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 347735 | SERINC2 | serine incorporator 2 | NM_178865.5 | 99.7% | 99.7% | 450T>C;1089_1090insCAG |
| 2 | human | 347735 | SERINC2 | serine incorporator 2 | NM_018565.3 | 97.2% | 97.6% | (many diffs) |
| 3 | human | 347735 | SERINC2 | serine incorporator 2 | NM_001199037.1 | 97.2% | 94.8% | (many diffs) |
| 4 | human | 347735 | SERINC2 | serine incorporator 2 | NM_001199038.2 | 96.2% | 95.4% | (many diffs) |
| 5 | human | 347735 | SERINC2 | serine incorporator 2 | NM_001199039.2 | 87.6% | 87.7% | 0_1ins165;285T>C;924_925insCAG |
| 6 | mouse | 230779 | Serinc2 | serine incorporator 2 | NM_172702.3 | 84.3% | 85.9% | (many diffs) |
| 7 | mouse | 230779 | Serinc2 | serine incorporator 2 | NM_001253386.1 | 73.7% | 75% | (many diffs) |
| 8 | mouse | 230779 | Serinc2 | serine incorporator 2 | XM_006503064.3 | 73.7% | 75% | (many diffs) |
| 9 | mouse | 230779 | Serinc2 | serine incorporator 2 | XM_006503065.3 | 73.7% | 75% | (many diffs) |
| 10 | mouse | 230779 | Serinc2 | serine incorporator 2 | XM_006503066.1 | 73.7% | 75% | (many diffs) |
| 11 | mouse | 230779 | Serinc2 | serine incorporator 2 | XM_017320158.1 | 73.7% | 75% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1437
- ORF length:
- 1368
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggggcctgc ctgggagcct gctccctgct cagctgcgcg tcctgcctct 121 gcggctctgc cccctgcatc ctgtgcagct gctgccccgc cagccgcaac tccaccgtga 181 gccgcctcat cttcacgttc ttcctcttcc tgggggtgct ggtgtccatc attatgctga 241 gcccgggcgt ggagagtcag ctctacaagc tgccctgggt gtgtgaggag ggggccggga 301 tccccaccgt cctgcagggc cacatcgact gtggctccct gcttggctac cgcgctgtct 361 accgcatgtg cttcgccacg gcggccttct tcttcttttt caccctgctc atgctctgcg 421 tgagcagcag ccgggacccc cgggctgcca tccagaatgg gttttggttc tttaagttcc 481 tgatcctggt gggcctcacc gtgggtgcct tctacatccc tgacggctcc ttcaccaaca 541 tctggttcta cttcggcgtc gtgggctcct tcctcttcat cctcatccag ctggtgctgc 601 tcatcgactt tgcgcactcc tggaaccagc ggtggctggg caaggccgag gagtgcgatt 661 cccgtgcctg gtacgcaggc ctcttcttct tcactctcct cttctacttg ctgtcgatcg 721 cggccgtggc gctgatgttc atgtactaca ctgagcccag cggctgccac gagggcaagg 781 tcttcatcag cctcaacctc accttctgtg tctgcgtgtc catcgctgct gtcctgccca 841 aggtccagga cgcccagccc aactcgggtc tgctgcaggc ctcggtcatc accctctaca 901 ccatgtttgt cacctggtca gccctatcca gtatccctga acagaaatgc aacccccatt 961 tgccaaccca gctgggcaac gagacagttg tggcaggccc cgagggctat gagacccagt 1021 ggtgggatgc cccgagcatt gtgggcctca tcatcttcct cctgtgcacc ctcttcatca 1081 gtctgcgctc cTCAGACCAC CGGCAGGTGA ACAGCCTGAT GCAGACCGAG GAGTGCCCAC 1141 CTATGCTAGA CGCCACACAG CAGCAGCAGC AGCAGGTGGC AGCCTGTGAG GGCCGGGCCT 1201 TTGACAACGA GCAGGACGGC GTCACCTACA GCTACTCCTT CTTCCACTTC TGCCTGGTGC 1261 TGGCCTCACT GCACGTCATG ATGACGCTCA CCAACTGGTA CAAGCCCGGT GAGACCCGGA 1321 AGATGATCAG CACGTGGACC GCCGTGTGGG TGAAGATCTG TGCCAGCTGG GCAGGGCTGC 1381 TCCTCTACCT GTGGACCCTG GTAGCCCCAC TCCTCCTGCG CAACCGCGAC TTCAGCTTGC 1441 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1501 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1561 ATATATCTTG TGGAAAGGAC GAGCAGCAGC CCAGATTTAG GCCAACACGC GTTAAGTCga 1621 caatcaacct ctggattaca aaatttgtga aagatt