Transcript: Mouse XM_017320158.1

PREDICTED: Mus musculus serine incorporator 2 (Serinc2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serinc2 (230779)
Length:
5289
CDS:
3667..4854

Additional Resources:

NCBI RefSeq record:
XM_017320158.1
NBCI Gene record:
Serinc2 (230779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119378 CCTCCGTCATAACCTTGTATA pLKO.1 4313 CDS 100% 13.200 18.480 N Serinc2 n/a
2 TRCN0000119377 CCTTCCTTTGCCCATGATCAT pLKO.1 5017 3UTR 100% 4.950 3.465 N Serinc2 n/a
3 TRCN0000119380 GCTGATCCTGTTTGTTGACTT pLKO.1 4023 CDS 100% 4.950 3.465 N Serinc2 n/a
4 TRCN0000119379 CCTTCTTCATTAGCCTGCGAT pLKO.1 4496 CDS 100% 2.640 1.848 N Serinc2 n/a
5 TRCN0000119381 GCTCAAGTCAGGATTCTCCAT pLKO.1 4946 3UTR 100% 2.640 1.848 N Serinc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13614 pDONR223 100% 73.7% 75% None (many diffs) n/a
2 ccsbBroad304_13614 pLX_304 0% 73.7% 75% V5 (many diffs) n/a
3 TRCN0000478251 GCAGCAGCCCAGATTTAGGCCAAC pLX_317 25.5% 73.7% 75% V5 (many diffs) n/a
4 ccsbBroadEn_13613 pDONR223 100% 22.5% 22.8% None (many diffs) n/a
5 ccsbBroad304_13613 pLX_304 0% 22.5% 22.8% V5 (many diffs) n/a
6 TRCN0000467006 AACACAACTGCTTAACGTGATTGC pLX_317 100% 22.5% 22.8% V5 (many diffs) n/a
Download CSV