Transcript: Human NM_001199039.2

Homo sapiens serine incorporator 2 (SERINC2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SERINC2 (347735)
Length:
2808
CDS:
1127..2329

Additional Resources:

NCBI RefSeq record:
NM_001199039.2
NBCI Gene record:
SERINC2 (347735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245571 TGGTCAGCCCTATCCAGTATC pLKO_005 1808 CDS 100% 10.800 15.120 N SERINC2 n/a
2 TRCN0000245570 ACTCAGCATCTCGGATGAAAG pLKO_005 2593 3UTR 100% 10.800 8.640 N SERINC2 n/a
3 TRCN0000245569 CGCCTCATCTTCACGTTCTTC pLKO_005 1076 5UTR 100% 4.950 3.465 N SERINC2 n/a
4 TRCN0000178798 CTTCACCAACATCTGGTTCTA pLKO.1 1423 CDS 100% 4.950 3.465 N SERINC2 n/a
5 TRCN0000147561 GATGTTCATGTACTACACTGA pLKO.1 1627 CDS 100% 2.640 1.848 N SERINC2 n/a
6 TRCN0000245568 GTGCTGGTGTCCATCATTATG pLKO_005 1109 5UTR 100% 13.200 7.920 N SERINC2 n/a
7 TRCN0000245572 ATCACCCTCTACACCATGTTT pLKO_005 1781 CDS 100% 5.625 3.375 N SERINC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13614 pDONR223 100% 87.6% 87.7% None 0_1ins165;285T>C;924_925insCAG n/a
2 ccsbBroad304_13614 pLX_304 0% 87.6% 87.7% V5 0_1ins165;285T>C;924_925insCAG n/a
3 TRCN0000478251 GCAGCAGCCCAGATTTAGGCCAAC pLX_317 25.5% 87.6% 87.7% V5 0_1ins165;285T>C;924_925insCAG n/a
4 ccsbBroadEn_13613 pDONR223 100% 26.1% 26.1% None 1_885del;924_925insCAG n/a
5 ccsbBroad304_13613 pLX_304 0% 26.1% 26.1% V5 1_885del;924_925insCAG n/a
6 TRCN0000467006 AACACAACTGCTTAACGTGATTGC pLX_317 100% 26.1% 26.1% V5 1_885del;924_925insCAG n/a
Download CSV