Construct: ORF TRCN0000478293
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017468.1_s317c1
- Derived from:
- ccsbBroadEn_03907
- DNA Barcode:
- CGAGCCTAATGGTTAAAACCCCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BLOC1S5 (63915)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478293
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63915 | BLOC1S5 | biogenesis of lysosomal org... | NM_201280.3 | 100% | 100% | |
| 2 | human | 63915 | BLOC1S5 | biogenesis of lysosomal org... | NM_001199322.1 | 65.5% | 65.2% | 1_1delAins191;3_4insAA |
| 3 | human | 63915 | BLOC1S5 | biogenesis of lysosomal org... | NM_001199323.1 | 48.1% | 37.1% | 195_196ins130;270_271ins161 |
| 4 | human | 100526837 | EEF1E1-BLOC1S5 | EEF1E1-BLOC1S5 readthrough ... | NR_037618.1 | 17.9% | (many diffs) | |
| 5 | human | 100526836 | BLOC1S5-TXNDC5 | BLOC1S5-TXNDC5 readthrough ... | NR_037616.1 | 14.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 630
- ORF length:
- 561
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtggcgga gggacagaga cccctgtggg ttgtgaggcc gccccgggcg 121 gtggcagcaa gaagagggac tccctgggga ctgcgggctc agcgcacctc attatcaagg 181 atcttggaga aattcattca aggcttttgg atcacagacc agttattcaa ggtgaaactc 241 gttattttgt aaaagaattt gaagaaaaac gtggtcttcg agaaatgcga gttcttgaaa 301 atttgaagaa catgatccat gaaacaaatg aacatactct tcccaaatgt agagacacaa 361 tgcgggacag ccTCAGCCAG GTTCTCCAGA GATTGCAAGC AGCTAATGAC TCAGTCTGTA 421 GACTCCAACA GAGGGAACAG GAACGAAAAA AGATTCATAG TGACCACTTA GTAGCTAGTG 481 AGAAACAGCA TATGCTCCAG TGGGACAACT TCATGAAGGA GCAACCCAAC AAAAGGGCTG 541 AAGTGGATGA AGAGCACAGA AAAGCCATGG AAAGGCTTAA AGAACAATAT GCTGAGATGG 601 AGAAGGACCT AGCGAAATTT TCAACCTTTT TGCCAACTTT CTTGTACAAA GTGGTTGATA 661 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 721 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACGAGC 781 CTAATGGTTA AAACCCCGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 841 tgaaagatt