Transcript: Human NM_201280.3

Homo sapiens biogenesis of lysosomal organelles complex 1 subunit 5 (BLOC1S5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BLOC1S5 (63915)
Length:
2659
CDS:
14..577

Additional Resources:

NCBI RefSeq record:
NM_201280.3
NBCI Gene record:
BLOC1S5 (63915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129117 GCCTTCCAGCACTTACTATTT pLKO.1 1235 3UTR 100% 13.200 6.600 Y BLOC1S5 n/a
2 TRCN0000280300 GCCTTCCAGCACTTACTATTT pLKO_005 1235 3UTR 100% 13.200 6.600 Y BLOC1S5 n/a
3 TRCN0000128920 GCTCAGAGAACTGTAGGTATA pLKO.1 872 3UTR 100% 10.800 5.400 Y BLOC1S5 n/a
4 TRCN0000280245 GCTCAGAGAACTGTAGGTATA pLKO_005 872 3UTR 100% 10.800 5.400 Y BLOC1S5 n/a
5 TRCN0000183759 CACCTCATTATCAAGGATCTT pLKO.1 110 CDS 100% 4.950 2.475 Y Bloc1s5 n/a
6 TRCN0000128812 CCACTTAGTAGCTAGTGAGAA pLKO.1 409 CDS 100% 4.950 2.475 Y BLOC1S5 n/a
7 TRCN0000280303 CCACTTAGTAGCTAGTGAGAA pLKO_005 409 CDS 100% 4.950 2.475 Y BLOC1S5 n/a
8 TRCN0000179600 GCACCTCATTATCAAGGATCT pLKO.1 109 CDS 100% 4.050 2.025 Y Bloc1s5 n/a
9 TRCN0000129404 GACTCAGTCTGTAGACTCCAA pLKO.1 353 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
10 TRCN0000129482 GCAGCTAATGACTCAGTCTGT pLKO.1 344 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
11 TRCN0000280246 GCAGCTAATGACTCAGTCTGT pLKO_005 344 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
12 TRCN0000130535 GTAGCTAGTGAGAAACAGCAT pLKO.1 416 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03907 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03907 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478293 CGAGCCTAATGGTTAAAACCCCGC pLX_317 45.8% 100% 100% V5 n/a
Download CSV