Transcript: Human NM_001199323.1

Homo sapiens biogenesis of lysosomal organelles complex 1 subunit 5 (BLOC1S5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
BLOC1S5 (63915)
Length:
2565
CDS:
39..311

Additional Resources:

NCBI RefSeq record:
NM_001199323.1
NBCI Gene record:
BLOC1S5 (63915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129117 GCCTTCCAGCACTTACTATTT pLKO.1 1130 3UTR 100% 13.200 6.600 Y BLOC1S5 n/a
2 TRCN0000280300 GCCTTCCAGCACTTACTATTT pLKO_005 1130 3UTR 100% 13.200 6.600 Y BLOC1S5 n/a
3 TRCN0000128920 GCTCAGAGAACTGTAGGTATA pLKO.1 767 3UTR 100% 10.800 5.400 Y BLOC1S5 n/a
4 TRCN0000280245 GCTCAGAGAACTGTAGGTATA pLKO_005 767 3UTR 100% 10.800 5.400 Y BLOC1S5 n/a
5 TRCN0000183759 CACCTCATTATCAAGGATCTT pLKO.1 135 CDS 100% 4.950 2.475 Y Bloc1s5 n/a
6 TRCN0000128812 CCACTTAGTAGCTAGTGAGAA pLKO.1 304 CDS 100% 4.950 2.475 Y BLOC1S5 n/a
7 TRCN0000280303 CCACTTAGTAGCTAGTGAGAA pLKO_005 304 CDS 100% 4.950 2.475 Y BLOC1S5 n/a
8 TRCN0000179600 GCACCTCATTATCAAGGATCT pLKO.1 134 CDS 100% 4.050 2.025 Y Bloc1s5 n/a
9 TRCN0000129404 GACTCAGTCTGTAGACTCCAA pLKO.1 248 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
10 TRCN0000129482 GCAGCTAATGACTCAGTCTGT pLKO.1 239 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
11 TRCN0000280246 GCAGCTAATGACTCAGTCTGT pLKO_005 239 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
12 TRCN0000130535 GTAGCTAGTGAGAAACAGCAT pLKO.1 311 CDS 100% 2.640 1.320 Y BLOC1S5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03907 pDONR223 100% 48.1% 37.1% None 195_196ins130;270_271ins161 n/a
2 ccsbBroad304_03907 pLX_304 0% 48.1% 37.1% V5 195_196ins130;270_271ins161 n/a
3 TRCN0000478293 CGAGCCTAATGGTTAAAACCCCGC pLX_317 45.8% 48.1% 37.1% V5 195_196ins130;270_271ins161 n/a
Download CSV