Construct: ORF TRCN0000478344
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004988.1_s317c1
- Derived from:
- ccsbBroadEn_08200
- DNA Barcode:
- ACCAGACTGTGTGTCAACAGTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CELA2B (51032)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478344
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51032 | CELA2B | chymotrypsin like elastase 2B | NM_015849.3 | 99.5% | 98.8% | (many diffs) |
| 2 | human | 63036 | CELA2A | chymotrypsin like elastase 2A | NM_033440.3 | 93.3% | 89.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 876
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gattaggacc ctgctgctgt ccactttggt ggctggagcc ctcagttgtg 121 gggtctccac ttacgcgcct gatatgtcta ggatgcttgg aggtgaagaa gcgaggccca 181 acagctggcc ctggcaggtc tccctgcagt acagctccaa tggccagtgg taccacacct 241 gcggagggtc cctgatagcc aacagctggg tcctgacggc tgcccactgc atcagctcct 301 ccaggatcta ccgcgtgatg ctgggccagc ataacctcta cgttgcagag tccggctcgc 361 tggccgtcag tgtctctaag attgtggtgc acaaggactg gaactccaac caggtctcca 421 aagggaacga cattgccctg ctcaaactgg ctaaccccgt ctccctcacc gacaagatcc 481 agctggcctg cctccctcct gccggcacca ttctacccaa caactacccc tgcTACGTCA 541 CAGGCTGGGG AAGGCTGCAG ACCAACGGGG CTCTCCCTGA TGACCTGAAG CAGGGCCGGT 601 TGCTGGTTGT GGACTATGCC ACCTGCTCCA GCTCTGGCTG GTGGGGCAGC ACCGTGAAGA 661 CGAATATGAT CTGTGCTGGG GGTGATGGCG TGATATGCAC CTGCAACGGA GACTCCGGTG 721 GGCCGCTGAA CTGTCAGGCA TCTGACGGCC GGTGGGAGGT GCATGGCATC GGCAGCCTCA 781 CGTCGGTCCT TGGTTGCAAC TACTACTACA AGCCCTCCAT CTTCACGCGG GTCTCCAACT 841 ACAACGACTG GATCAATTCG GTGATTGCAA ATAACTTGCC AACTTTCTTG TACAAAGTGG 901 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 961 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1021 AACCAGACTG TGTGTCAACA GTCAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1081 aatttgtgaa agatt