Construct: ORF TRCN0000478359
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006488.1_s317c1
- Derived from:
- ccsbBroadEn_02986
- DNA Barcode:
- CTTCGACCTAATGCCCACCGAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NSG1 (27065)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478359
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27065 | NSG1 | neuronal vesicle traffickin... | NM_001040101.1 | 100% | 100% | |
2 | human | 27065 | NSG1 | neuronal vesicle traffickin... | NM_001287763.1 | 100% | 100% | |
3 | human | 27065 | NSG1 | neuronal vesicle traffickin... | NM_014392.4 | 100% | 100% | |
4 | human | 27065 | NSG1 | neuronal vesicle traffickin... | NM_001287764.1 | 85.4% | 85.4% | 0_1ins81 |
5 | mouse | 18196 | Nsg1 | neuron specific gene family... | NM_010942.3 | 93.1% | 98.3% | (many diffs) |
6 | mouse | 18196 | Nsg1 | neuron specific gene family... | XM_006503773.1 | 93.1% | 98.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 621
- ORF length:
- 555
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaagttgggg aacaatttcg cagagaaggg caccaagcag ccgctgctgg 121 aggatggctt cgacaccatt cccctgatga cgcccctcga tgtcaatcag ctgcagttcc 181 cgcccccgga taaggtggtc gtgaaaacta agaccgagta tgaacctgac cgcaagaaag 241 ggaaagcacg tcctccccaa attgctgagt tcaccgtcag catcacggag ggtgtcaccg 301 agaggtttaa ggtctccgtg ttggtcctct tcgccctggc cttcctcacc TGCGTCGTCT 361 TCCTGGTTGT CTACAAGGTG TACAAGTATG ACCGCGCCTG CCCCGATGGG TTCGTCCTCA 421 AGAACACCCA GTGCATCCCA GAAGGCTTGG AGAGCTACTA CGCGGAGCAA GACTCCAGTG 481 CCCGGGAGAA ATTTTACACA GTCATAAACC ACTACAACCT GGCCAAGCAG AGCATCACGC 541 GCTCCGTATC GCCCTGGATG TCAGTTCTGT CAGAAGAGAA GCTGTCCGAG CAGGAGACTG 601 AAGCGGCTGA GAAGTCAGCT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 661 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 721 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTTC GACCTAATGC 781 CCACCGAGAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt