Transcript: Mouse NM_010942.3

Mus musculus neuron specific gene family member 1 (Nsg1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nsg1 (18196)
Length:
2140
CDS:
104..661

Additional Resources:

NCBI RefSeq record:
NM_010942.3
NBCI Gene record:
Nsg1 (18196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319584 GACCTTACTCCATAGCCATAT pLKO_005 1033 3UTR 100% 10.800 15.120 N Nsg1 n/a
2 TRCN0000104936 CCAGATAAGGTCGTGGTGAAA pLKO.1 224 CDS 100% 4.950 6.930 N Nsg1 n/a
3 TRCN0000104935 CGTCCTTTAGTAGGTCAGAAA pLKO.1 1742 3UTR 100% 4.950 6.930 N Nsg1 n/a
4 TRCN0000104938 CTTCGACACCATTCCTTTGAT pLKO.1 166 CDS 100% 5.625 4.500 N Nsg1 n/a
5 TRCN0000104939 CCCTGATGGGTTTGTCTTGAA pLKO.1 439 CDS 100% 4.950 3.960 N Nsg1 n/a
6 TRCN0000317978 CCCTGATGGGTTTGTCTTGAA pLKO_005 439 CDS 100% 4.950 3.960 N Nsg1 n/a
7 TRCN0000319649 AGGATGGCTTCGACACCATTC pLKO_005 159 CDS 100% 6.000 4.200 N Nsg1 n/a
8 TRCN0000104937 CCTGGTTGTCTACAAAGTGTA pLKO.1 400 CDS 100% 4.950 3.465 N Nsg1 n/a
9 TRCN0000317908 CCTGGTTGTCTACAAAGTGTA pLKO_005 400 CDS 100% 4.950 3.465 N Nsg1 n/a
10 TRCN0000350031 GGGTGTCACCGAGAGGTTTAA pLKO_005 328 CDS 100% 13.200 7.920 N Nsg1 n/a
11 TRCN0000161637 GTCAGTTCTGTCAGAAGAGAA pLKO.1 598 CDS 100% 4.950 2.970 N NSG1 n/a
12 TRCN0000163418 GAGGTTTAAGGTCTCCGTGTT pLKO.1 340 CDS 100% 4.050 5.670 N NSG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02986 pDONR223 100% 93.1% 98.3% None (many diffs) n/a
2 ccsbBroad304_02986 pLX_304 0% 93.1% 98.3% V5 (many diffs) n/a
3 TRCN0000478359 CTTCGACCTAATGCCCACCGAGAT pLX_317 48.8% 93.1% 98.3% V5 (many diffs) n/a
Download CSV