Transcript: Human NM_001040101.1

Homo sapiens neuronal vesicle trafficking associated 1 (NSG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NSG1 (27065)
Length:
2635
CDS:
415..972

Additional Resources:

NCBI RefSeq record:
NM_001040101.1
NBCI Gene record:
NSG1 (27065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350031 GGGTGTCACCGAGAGGTTTAA pLKO_005 639 CDS 100% 13.200 10.560 N Nsg1 n/a
2 TRCN0000159420 GAGCAATAAATCAGTGCCAAA pLKO.1 2416 3UTR 100% 4.050 3.240 N NSG1 n/a
3 TRCN0000159194 GCTCCTTTACTGGGATTTATT pLKO.1 1216 3UTR 100% 15.000 10.500 N NSG1 n/a
4 TRCN0000158992 GTCTACAAGGTGTACAAGTAT pLKO.1 718 CDS 100% 5.625 3.938 N NSG1 n/a
5 TRCN0000159971 CACAGTCATAAACCACTACAA pLKO.1 846 CDS 100% 4.950 3.465 N NSG1 n/a
6 TRCN0000161637 GTCAGTTCTGTCAGAAGAGAA pLKO.1 909 CDS 100% 4.950 3.465 N NSG1 n/a
7 TRCN0000164112 CCTGGTTGTCTACAAGGTGTA pLKO.1 711 CDS 100% 4.050 2.835 N NSG1 n/a
8 TRCN0000164131 CGATGTCAATCAGCTGCAGTT pLKO.1 507 CDS 100% 4.050 2.835 N NSG1 n/a
9 TRCN0000163418 GAGGTTTAAGGTCTCCGTGTT pLKO.1 651 CDS 100% 4.050 2.835 N NSG1 n/a
10 TRCN0000164352 CTTCCTGGTTGTCTACAAGGT pLKO.1 708 CDS 100% 2.640 1.848 N NSG1 n/a
11 TRCN0000163754 GTTTAAGGTCTCCGTGTTGGT pLKO.1 654 CDS 100% 2.640 1.848 N NSG1 n/a
12 TRCN0000319649 AGGATGGCTTCGACACCATTC pLKO_005 470 CDS 100% 6.000 3.600 N Nsg1 n/a
13 TRCN0000163910 CGAAGGGTTTGGATCTCAGAT pLKO.1 1272 3UTR 100% 4.950 2.970 N NSG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02986 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02986 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478359 CTTCGACCTAATGCCCACCGAGAT pLX_317 48.8% 100% 100% V5 n/a
Download CSV