Construct: ORF TRCN0000478380
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018163.2_s317c1
- Derived from:
- ccsbBroadEn_01247
- DNA Barcode:
- TCAGGTGTTAGATCCGGCTGGGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- POU2AF1 (5450)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478380
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | NM_006235.3 | 100% | 100% | |
| 2 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | XM_006718859.1 | 91.4% | 90.9% | (many diffs) |
| 3 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | XM_005271593.2 | 83.8% | 82.5% | (many diffs) |
| 4 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | XM_005271594.3 | 83.8% | 82.5% | (many diffs) |
| 5 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | XM_017017932.1 | 60.6% | 59.7% | (many diffs) |
| 6 | human | 5450 | POU2AF1 | POU class 2 homeobox associ... | XM_006718860.4 | 50.6% | 48.5% | (many diffs) |
| 7 | mouse | 18985 | Pou2af1 | POU domain, class 2, associ... | NM_011136.2 | 86.2% | 89.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 834
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ctggcaaaaa cccacagctc cggagcaagc cccagccccg gcccggccat 121 accagggcgt ccgtgtgaag gagccagtga aggaactgct gaggaggaag cgaggccacg 181 ccagcagtgg ggcagcacct gcacctacgg cggtggtgct gccccatcag cccctggcga 241 cctacaccac agtgggtcct tcctgcctgg acatggaagg ttctgtgtct gcagtgacag 301 aggaggctgc cctgtgtgcc ggctggctct cccagcccac cccggccacc ctgcagcccc 361 tggccccatg gacaccttac accgagtatg tgccccatga agctgtcagc tgcccctact 421 cagctgacat gtatgtgcag cccgtgtgcc ccagctacac ggtggtgggg ccctcctcag 481 tgttgaccta tgcctctccg ccactcatca ccaatgtcac gacaagaagc TCCGCCACGC 541 CCGCAGTGGG GCCCCCGCTG GAGGGCCCAG AGCACCAGGC ACCCCTCACC TATTTCCCGT 601 GGCCTCAGCC CCTTTCCACA CTACCCACCT CCACCCTGCA GTACCAGCCT CCGGCCCCAG 661 CCCTACCTGG GCCCCAGTTT GTCCAGCTCC CCATCTCTAT CCCAGAGCCA GTCCTTCAGG 721 ACATGGAAGA CCCCAGAAGA GCCGCCAGCT CGTTGACCAT CGACAAGCTG CTTTTGGAGG 781 AAGAGGATAG CGACGCCTAT GCGCTTAACC ACACTCTCTC TGTGGAAGGC TTTTACCCAA 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAT CAGGTGTTAG ATCCGGCTGG GTTACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att