Transcript: Mouse NM_011136.2

Mus musculus POU domain, class 2, associating factor 1 (Pou2af1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pou2af1 (18985)
Length:
2566
CDS:
97..867

Additional Resources:

NCBI RefSeq record:
NM_011136.2
NBCI Gene record:
Pou2af1 (18985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086513 GCGGCAAATGATAGTGATATT pLKO.1 1090 3UTR 100% 13.200 18.480 N Pou2af1 n/a
2 TRCN0000086515 TCACTAATGTCACGCCAAGAA pLKO.1 539 CDS 100% 4.950 6.930 N Pou2af1 n/a
3 TRCN0000086514 TCATCACTAATGTCACGCCAA pLKO.1 536 CDS 100% 2.160 3.024 N Pou2af1 n/a
4 TRCN0000086516 CCTGCCTTGACATGGAGGTTT pLKO.1 293 CDS 100% 4.950 3.465 N Pou2af1 n/a
5 TRCN0000086517 CCAGTCCTTCAGGACATGGAT pLKO.1 739 CDS 100% 3.000 2.100 N Pou2af1 n/a
6 TRCN0000021680 CCAGTCCTTCAGGACATGGAA pLKO.1 739 CDS 100% 3.000 2.100 N POU2AF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01247 pDONR223 100% 86.2% 89.4% None (many diffs) n/a
2 ccsbBroad304_01247 pLX_304 0% 86.2% 89.4% V5 (many diffs) n/a
3 TRCN0000478380 TCAGGTGTTAGATCCGGCTGGGTT pLX_317 39.8% 86.2% 89.4% V5 (many diffs) n/a
Download CSV