Transcript: Human XM_006718860.4

PREDICTED: Homo sapiens POU class 2 homeobox associating factor 1 (POU2AF1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU2AF1 (5450)
Length:
5546
CDS:
767..1381

Additional Resources:

NCBI RefSeq record:
XM_006718860.4
NBCI Gene record:
POU2AF1 (5450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423580 GGGAGGTAATTATAGGGATTT pLKO_005 3951 3UTR 100% 10.800 15.120 N POU2AF1 n/a
2 TRCN0000431764 GTGGTCCATGGGCTTTCATTT pLKO_005 4008 3UTR 100% 13.200 9.240 N POU2AF1 n/a
3 TRCN0000412363 TCATTTCATGACTACACTTTC pLKO_005 3627 3UTR 100% 10.800 7.560 N POU2AF1 n/a
4 TRCN0000021679 TGGACACCTTACACCGAGTAT pLKO.1 1211 CDS 100% 4.950 3.465 N POU2AF1 n/a
5 TRCN0000021683 GAAGAGGATAGCGACGCCTAT pLKO.1 3480 3UTR 100% 4.050 2.835 N POU2AF1 n/a
6 TRCN0000021680 CCAGTCCTTCAGGACATGGAA pLKO.1 3408 3UTR 100% 3.000 2.100 N POU2AF1 n/a
7 TRCN0000021682 CCTACACCACAGTGGGTCCTT pLKO.1 1083 CDS 100% 0.880 0.616 N POU2AF1 n/a
8 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4995 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
9 TRCN0000086517 CCAGTCCTTCAGGACATGGAT pLKO.1 3408 3UTR 100% 3.000 2.100 N Pou2af1 n/a
10 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 5065 3UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01247 pDONR223 100% 50.6% 48.5% None (many diffs) n/a
2 ccsbBroad304_01247 pLX_304 0% 50.6% 48.5% V5 (many diffs) n/a
3 TRCN0000478380 TCAGGTGTTAGATCCGGCTGGGTT pLX_317 39.8% 50.6% 48.5% V5 (many diffs) n/a
Download CSV