Construct: ORF TRCN0000478410
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012428.1_s317c1
- Derived from:
- ccsbBroadEn_09479
- DNA Barcode:
- TGATAGCGGTCTACTATTTCTCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA2L (124044)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478410
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 124044 | SPATA2L | spermatogenesis associated ... | NM_152339.4 | 99.9% | 99.7% | 28T>N |
| 2 | human | 124044 | SPATA2L | spermatogenesis associated ... | XM_005256279.5 | 99.9% | 99.7% | 28T>N |
| 3 | mouse | 78779 | Spata2l | spermatogenesis associated ... | NM_030176.2 | 80.9% | 85% | (many diffs) |
| 4 | mouse | 78779 | Spata2l | spermatogenesis associated ... | XM_006531504.3 | 80.9% | 85% | (many diffs) |
| 5 | mouse | 78779 | Spata2l | spermatogenesis associated ... | XM_006531505.3 | 80.9% | 85% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1338
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cagcagctcg ctgtccgagg acnaccgcca gtgcctggag cgcgagctgc 121 gacggggccg cgcgggcgtg tgcggggacc cctcgctgcg cgcggtgctc tggcagatcc 181 tggtggagga cttcgacctg cacggggcgc tgcaggacga cgcgctggct ctgctcaccg 241 acgggctgtg gggccgcgcc gacctggcgc ccgcgctacg cggcctggct cgcgccttcg 301 agcttctgga gctcgccgcg gtgcacctgt acctgctgcc ctggaggaag gagttcacca 361 ccatcaagac cttctctggg ggctacgtgc acgtgctgaa gggtgtgctc tcagacgacc 421 tcctcctgaa gagcttccag aagatgggct acgtacgcag agacagccat cggctcatgg 481 tgaccgccct gccccccgcc tgccagctgg tgcaggtggc cctgggctgc ttcgccctcc 541 ggctggagtg tgagatcctg ggtgaggtgc tggcccagct gggcaccagt gtgctgccag 601 ctgaggagct gctgcaggca cggcgtgcca gcggggacgt ggcctcctgt gtggcctggc 661 tgcagcagcg gctggcccag gatgaggagc cgccacccct gcccccccga ggctcccctg 721 ctgcttacag ggccccactg gacttatacc gggacttgca ggaagacgag gggtcggagg 781 acgccagcct gtatggggag ccgtcaccag gccctgactc gcccccggcg gagctggcct 841 acaggccacc actctgggag cagagtgcca aactgtgggg cactgggggc cgggcctggg 901 agcccccagc tgaggagctg ccgcaggcca gcagcccacc atatggggcc ttggaggagg 961 ggctggaacc tgaaccttcc gccttctccT TCCTCTCTCT GCGCCGTGAG CTGAGTAGGC 1021 CTGGGGACCT GGCCACCCCT GAAAGCTCTG CAGCGGCCAG CCCGAGGCGT ATTCGGGCAG 1081 AGGGGGTACC AGCCTCAGCC TATAGGTCTG TCTCGGAGCC CCCAGGCTAC CAGGCACACA 1141 GCTGCCTGTC CCCTGGCGCC CTGCCCACCC TCTGCTGCGA CACCTGTCGC CAGCTGCATG 1201 CTGCCCACTG TGCAGCCCTG CCCGCCTGCC GTCCAGGCCA CTCGCTGCGT GTGCTGCTTG 1261 GCGACGCCCA GCGGCGCTTG TGGCTACAGC GTGCACAGAT GGACACTCTG CTCTACAACA 1321 GCCCCGGGGC CCGGCCCTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1381 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1441 GTATTTCGAT TTCTTGGTTT TATATATCTT GTGGAAAGGA CGATGATAGC GGTCTACTAT 1501 TTCTCCAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt