Transcript: Human NM_152339.4

Homo sapiens spermatogenesis associated 2 like (SPATA2L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SPATA2L (124044)
Length:
2331
CDS:
80..1354

Additional Resources:

NCBI RefSeq record:
NM_152339.4
NBCI Gene record:
SPATA2L (124044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152339.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242738 CTTGGTGGGTCCAGTGGTAAT pLKO_005 2067 3UTR 100% 10.800 7.560 N SPATA2L n/a
2 TRCN0000242740 AGGAGTTCACCACCATCAAGA pLKO_005 363 CDS 100% 4.950 3.465 N SPATA2L n/a
3 TRCN0000180930 GATGGACACTCTGCTCTACAA pLKO.1 1312 CDS 100% 4.950 3.465 N SPATA2L n/a
4 TRCN0000180078 CAGGAAATGACCTGACCTCAA pLKO.1 1926 3UTR 100% 4.050 2.835 N SPATA2L n/a
5 TRCN0000242739 TGGACTTATACCGGGACTTGC pLKO_005 753 CDS 100% 4.050 2.835 N SPATA2L n/a
6 TRCN0000242741 TACCAGCCTCAGCCTATAGGT pLKO_005 1101 CDS 100% 0.000 0.000 N SPATA2L n/a
7 TRCN0000242737 TGGACACTCTGCTCTACAACA pLKO_005 1314 CDS 100% 4.950 2.970 N SPATA2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152339.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09479 pDONR223 99.3% 99.9% 99.7% None 28T>N n/a
2 ccsbBroad304_09479 pLX_304 0% 99.9% 99.7% V5 28T>N n/a
3 TRCN0000478410 TGATAGCGGTCTACTATTTCTCCA pLX_317 27.7% 99.9% 99.7% V5 28T>N n/a
4 ccsbBroadEn_13100 pDONR223 100% 34.9% 33.4% None (many diffs) n/a
5 ccsbBroad304_13100 pLX_304 0% 34.9% 33.4% V5 (many diffs) n/a
6 TRCN0000491889 ACCTCTCTTGGAGTAATAACCTTA pLX_317 81.3% 34.9% 33.4% V5 (many diffs) n/a
Download CSV