Construct: ORF TRCN0000478504
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009931.1_s317c1
- Derived from:
- ccsbBroadEn_08912
- DNA Barcode:
- TCGGCGCCCCCAACCAACTGAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD15 (79047)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478504
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79047 | KCTD15 | potassium channel tetrameri... | NM_024076.3 | 99.5% | 98.7% | 8A>G;13A>G;190G>A |
| 2 | human | 79047 | KCTD15 | potassium channel tetrameri... | NM_001129994.2 | 82% | 80.9% | (many diffs) |
| 3 | human | 79047 | KCTD15 | potassium channel tetrameri... | NM_001129995.2 | 82% | 80.9% | (many diffs) |
| 4 | human | 79047 | KCTD15 | potassium channel tetrameri... | XM_011527296.2 | 82% | 80.9% | (many diffs) |
| 5 | human | 79047 | KCTD15 | potassium channel tetrameri... | XM_011527297.2 | 82% | 80.9% | (many diffs) |
| 6 | human | 79047 | KCTD15 | potassium channel tetrameri... | XM_011527298.2 | 82% | 80.9% | (many diffs) |
| 7 | human | 79047 | KCTD15 | potassium channel tetrameri... | XM_017027283.1 | 82% | 80.9% | (many diffs) |
| 8 | human | 79047 | KCTD15 | potassium channel tetrameri... | XR_935857.1 | 54.3% | (many diffs) | |
| 9 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | NM_146188.1 | 72.6% | 78.5% | (many diffs) |
| 10 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539900.1 | 72.6% | 78.5% | (many diffs) |
| 11 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539901.3 | 72.6% | 78.5% | (many diffs) |
| 12 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539902.3 | 72.6% | 78.5% | (many diffs) |
| 13 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539903.3 | 72.6% | 78.5% | (many diffs) |
| 14 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539904.3 | 72.6% | 78.5% | (many diffs) |
| 15 | mouse | 233107 | Kctd15 | potassium channel tetrameri... | XM_006539905.1 | 72.6% | 78.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 768
- ORF length:
- 702
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tcgccgcgag gagcggccga gcgggtcctc gcttcacaca cacggcagca 121 ccggcaccgc ggagggagga aacatgtccc ggctgtctct cacccggtcg cctgtgtctc 181 ccctggctgc ccagggcatc cccctgccag cccagctcac caagtccaat gcacctgtgc 241 acatcgatgt gggcagccac atgtacacca gcagcctggc cacgctcacc aagtaccctg 301 actccaggat aagccgcctc ttcaatggca ctgaacccat cgtcctggac agtttgaagc 361 aacattattt cattgaccgg gatggggaga ttttccgcta cgtcctgagc ttccTGCGGA 421 CGTCCAAGCT GCTGCTTCCG GATGACTTTA AGGACTTCAG TCTGCTGTAC GAGGAGGCGC 481 GCTACTATCA GCTCCAGCCC ATGGTGCGCG AGCTGGAGCG CTGGCAGCAG GAGCAGGAGC 541 AGCGGCGCCG CAGCCGGGCC TGTGACTGCC TGGTGGTGCG CGTCACGCCC GACTTGGGCG 601 AGCGGATCGC ACTCAGCGGC GAGAAGGCCC TCATCGAGGA GGTCTTCCCC GAGACCGGAG 661 ACGTCATGTG CAACTCCGTC AACGCCGGCT GGAACCAGGA CCCCACGCAC GTCATCCGCT 721 TCCCGCTCAA TGGCTACTGC CGGCTCAACT CGGTACAGGA TGTTCTATAC CCAACTTTCT 781 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 841 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 901 GTGGAAAGGA CGATCGGCGC CCCCAACCAA CTGAAGCACG CGTTAAGTCg acaatcaacc 961 tctggattac aaaatttgtg aaagatt