Transcript: Human NM_024076.3

Homo sapiens potassium channel tetramerization domain containing 15 (KCTD15), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
KCTD15 (79047)
Length:
4908
CDS:
245..949

Additional Resources:

NCBI RefSeq record:
NM_024076.3
NBCI Gene record:
KCTD15 (79047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043779 CGGCTCAACTCGGTACAGGAT pLKO.1 920 CDS 100% 0.880 1.232 N KCTD15 n/a
2 TRCN0000043782 GATCGCACTCAGCGGCGAGAA pLKO.1 784 CDS 100% 0.000 0.000 N KCTD15 n/a
3 TRCN0000043778 CTGGACAGTTTGAAGCAACAT pLKO.1 524 CDS 100% 4.950 3.960 N KCTD15 n/a
4 TRCN0000043780 AGTACCCTGACTCCAGGATAA pLKO.1 471 CDS 100% 10.800 7.560 N KCTD15 n/a
5 TRCN0000043781 TCCGGATGACTTTAAGGACTT pLKO.1 616 CDS 100% 4.050 2.835 N KCTD15 n/a
6 TRCN0000422229 GAGACGTCATGTGCAACTCTG pLKO_005 837 CDS 100% 4.050 2.835 N Kctd15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08912 pDONR223 100% 99.5% 98.7% None 8A>G;13A>G;190G>A n/a
2 ccsbBroad304_08912 pLX_304 0% 99.5% 98.7% V5 8A>G;13A>G;190G>A n/a
3 TRCN0000478504 TCGGCGCCCCCAACCAACTGAAGC pLX_317 50.4% 99.5% 98.7% V5 8A>G;13A>G;190G>A n/a
Download CSV