Transcript: Mouse XM_006539904.3

PREDICTED: Mus musculus potassium channel tetramerisation domain containing 15 (Kctd15), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd15 (233107)
Length:
3178
CDS:
1051..1902

Additional Resources:

NCBI RefSeq record:
XM_006539904.3
NBCI Gene record:
Kctd15 (233107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425557 TCCCTCTCAACGGCTACTGTA pLKO_005 1706 CDS 100% 4.950 6.930 N Kctd15 n/a
2 TRCN0000069468 CCCTTGTGTATAACGCCTGTA pLKO.1 3045 3UTR 100% 4.050 5.670 N Kctd15 n/a
3 TRCN0000069472 GAATATGTTCTTTGCCGGGAA pLKO.1 1822 CDS 100% 2.160 3.024 N Kctd15 n/a
4 TRCN0000435195 GTGAACGGATCGCACTCAGTG pLKO_005 1583 CDS 100% 1.350 1.890 N Kctd15 n/a
5 TRCN0000069471 GACAGTCTCAAGCAACATTAT pLKO.1 1333 CDS 100% 13.200 9.240 N Kctd15 n/a
6 TRCN0000069470 CAGGTCCTAGAAAGGCTGTTT pLKO.1 1741 CDS 100% 4.950 3.465 N Kctd15 n/a
7 TRCN0000069469 CTCCAGAATAAGCCGTCTCTT pLKO.1 1287 CDS 100% 4.950 3.465 N Kctd15 n/a
8 TRCN0000428408 GAGTTTCCTGCGGACGTCAAA pLKO_005 1392 CDS 100% 4.950 3.465 N Kctd15 n/a
9 TRCN0000424531 GGGTTGATGTGACCTGGTTGA pLKO_005 2098 3UTR 100% 4.050 2.835 N Kctd15 n/a
10 TRCN0000436129 ACATCGATGTGGGAGGTCACA pLKO_005 1226 CDS 100% 2.640 1.848 N Kctd15 n/a
11 TRCN0000438452 ACATGGAAATAGCGCTGAGGA pLKO_005 1955 3UTR 100% 2.640 1.848 N Kctd15 n/a
12 TRCN0000421202 CACGGCGGAGGGAGGAAATAT pLKO_005 1110 CDS 100% 5.000 3.000 N Kctd15 n/a
13 TRCN0000422229 GAGACGTCATGTGCAACTCTG pLKO_005 1643 CDS 100% 4.050 2.430 N Kctd15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08912 pDONR223 100% 72.6% 78.5% None (many diffs) n/a
2 ccsbBroad304_08912 pLX_304 0% 72.6% 78.5% V5 (many diffs) n/a
3 TRCN0000478504 TCGGCGCCCCCAACCAACTGAAGC pLX_317 50.4% 72.6% 78.5% V5 (many diffs) n/a
Download CSV