Construct: ORF TRCN0000478505
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009678.2_s317c1
- Derived from:
- ccsbBroadEn_05084
- DNA Barcode:
- ATCCTTTAGGCCGACATAGAACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IQUB (154865)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478505
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_001282855.1 | 100% | 100% | |
| 2 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_001321293.1 | 100% | 100% | |
| 3 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_178827.5 | 100% | 100% | |
| 4 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_005250161.3 | 100% | 100% | |
| 5 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_011515833.2 | 100% | 100% | |
| 6 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_011515834.3 | 100% | 100% | |
| 7 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_017011771.1 | 100% | 100% | |
| 8 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_005250162.5 | 94.7% | 92% | (many diffs) |
| 9 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NR_104244.1 | 71.9% | 1_164del;1921_2116del;2734_3298del | |
| 10 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NR_104245.1 | 70.5% | 1_177del;1411_1412ins176;2375_2939del | |
| 11 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_017011772.2 | 64.7% | 64.7% | 397_398ins837 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2442
- ORF length:
- 2373
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctaatcaa caggagaagt atgaagctca gaatatagtc aattcaacag 121 aagagagtga tgatgctttt gatactgtca ctattccagt tccctcagaa gagcctcaag 181 agtcagatca aactgaagag catgaatctg gaatagaaca attcagtgag agccatgcaa 241 tacatgttga ggagcagagt gaccaaagct tttcaagcct ggaaccagac aatgaacaac 301 tcatggaaga ggttatatca ccaagacaag tttcatatac tccgcaacat catgaaaagc 361 aatatgcaat gcagaggcca aatgatgata gtttggcatt tctggataaa ataaagtctg 421 taaaggaatc tttgcaagaa tcagtggaag attctctagc aacagtaaaa gttgtactta 481 ttccagtggg ccaggaaatt gtaatacctt ttaaggttga taccattctt aaatatctta 541 aggaccattt ttcacactta ttaggtatcc cacattctgt actgcagata agatactcag 601 gaaaaattct taaaaataat gagactctag tacaacatgg agttaagcca caggaaattg 661 tacaagtgga aatcttttct acaaatccag atctgtatcc agtcagaaga atagatggat 721 taactgatgt ctctcaaatc ataactgtca ctgtccaaac tggacttgat caataccagc 781 aggtacctgt tgagattgtc aaatctgact ttcacaaacc atttcttggt ggattcagac 841 ataaagtaac aggagtagag tatcacaatg ctggaacaca aactgtacct aaaaggattc 901 ccgaaagact cagtatattt tgtagggata cgcagacagt ttttcagaaa aaaaatctcc 961 aacaaactac aaatacaaca tccacacaga tgactaacat tggtgtatat gtatcaaata 1021 tgactgataa actggtaaca ccaggaaagt atttttcagc agcagaatac catgctcaaa 1081 gactaaaggc ggtgatagtg atacagactt actacaggca atggcatgct aaaatcttcg 1141 tagagaattt aagaagacag aaaagcttaa gactggaatg ggaaacacag caagaactaa 1201 ggaagataag agaaaaagaa gaatggataa aattggacta tcaccggagg cataatccta 1261 aaacaaatga agattttgaa tttctttata atgcattaga attctggcgg caagaagaac 1321 ttacacgtat taaccaatct tttactggag ctgaaaggaa agctgctctg tgtgaacttc 1381 tggaaaaaga gactcagata attgcttcca ttgggagaca tagatacatt gcttatatgg 1441 caaatcagga agcagcaata caagcttttt tggataagtg ttcagctcca aaaatatgga 1501 gaacccctaa tggcaaaaca attgagatgg atacgcagtt caccatcaga gccagagagc 1561 tgcaaaatat ctataagtgc attatgctga aaaatatctc ccaagatgag aggctggatg 1621 tgctgttaac tcttaaacac actgtaaagg aacatgaatg taaactaact caggaaattc 1681 tagaattgat tgacagagag gttgacctta tgatgagagg agtcaaacat cataaccttg 1741 aaggactcag aaaaagaatt gcgacactct tttttcatta tatcaaaaca cctctgttta 1801 atcctgaagt tgcaaaatac cttaaggtcc ctcaagaccc attgaaattt tataagaaga 1861 tttacttttg ccacagttgc cagctttatt tgccttctac agaattttct gtatcatcca 1921 cctcacgccg catataccgg tgtcgtaact gcattaacct tcagaatgag gctcaaaaac 1981 gagaatcatt tttgaagtac aaatgtttac ttcaacagct ctactataca gaagctgatt 2041 atgaagatga ttctaaaatt gctttcttga tgcagctaca agacattcag tacctgacag 2101 agaacatctg ggcgtcccag tcagtccTCA GTGCTTGCGA CAATCTCAGT GATCTGGTCA 2161 TGGTCAGATG GAATAAATCC CTGGAGTGGT CCCCCTGGAA CTGCATTCTT CTTACCAAAG 2221 ATGAAGCAGC TGCTCATCTC AAGCTAACAA GTATTGAAGA GGGATATGAA CGCTCATTTA 2281 TTCACAAGAT CAAACACAAA CATATCCTGG CTAAGAACTA TTTTTCTCAG GTTCCAGTGC 2341 TGGCTTCATT TATACTTGAT GATGGTGAAA TTGATGAGAT CAGATGGAAG TATCACTCAG 2401 ACACAACACC TAAGATTATA GAATCCCAGA GGCCTCCTCA TTTGCCAACT TTCTTGTACA 2461 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2521 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2581 AGGACGAATC CTTTAGGCCG ACATAGAACC CACGCGTTAA GTCgacaatc aacctctgga 2641 ttacaaaatt tgtgaaagat t