Construct: ORF TRCN0000478538
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004298.1_s317c1
- Derived from:
- ccsbBroadEn_03630
- DNA Barcode:
- GGTACGAACAGCCTGCTCAAACAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MREG (55686)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478538
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55686 | MREG | melanoregulin | NM_018000.3 | 100% | 100% | |
| 2 | human | 55686 | MREG | melanoregulin | NM_001372188.1 | 81% | 81% | 254_403del |
| 3 | human | 55686 | MREG | melanoregulin | NM_001372189.1 | 74.7% | 74.7% | 0_1ins162 |
| 4 | human | 55686 | MREG | melanoregulin | NM_001372190.1 | 74.7% | 74.7% | 0_1ins162 |
| 5 | human | 55686 | MREG | melanoregulin | XM_017004475.1 | 55.9% | 39.7% | (many diffs) |
| 6 | human | 55686 | MREG | melanoregulin | XR_001738842.1 | 44.9% | 1_146del;400_549del;939_1427del | |
| 7 | human | 55686 | MREG | melanoregulin | XR_001738844.1 | 36.7% | 1_146del;789_1745del | |
| 8 | human | 55686 | MREG | melanoregulin | XR_922965.1 | 33.9% | 1_146del;400_549del;939_1892del | |
| 9 | human | 55686 | MREG | melanoregulin | XR_001738843.1 | 32.7% | 1_146del;400_549del;939_1962del | |
| 10 | mouse | 381269 | Mreg | melanoregulin | NM_001005423.2 | 84.6% | 85.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 708
- ORF length:
- 642
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gctgagggac tggctgagaa ccgtgtgctg ctgctgcggg tgcgagtgct 121 tggaggagcg cgccctgcct gagaaggagc ccctcgtcag tgataacaat ccatattcct 181 catttggagc aactctggtg agggatgatg agaagaattt atggagtatg ccccatgatg 241 tgtcccacac agaggcagac gacgacagaa ccctgtacaa tttgatagtc attcgtaatc 301 agcaggccaa agactcagag gagtggcaga agctcaacta tgatatccat accctgcggc 361 aggttcGAAG GGAAGTAAGA AACAGATGGA AGTGCATCTT AGAAGATTTA GGTTTTCAAA 421 AGGAAGCTGA CTCTTTGTTG TCAGTGACTA AACTCAGCAC CATCAGTGAT TCTAAAAACA 481 CAAGGAAAGC TCGAGAGATG TTGTTAAAAC TGGCTGAAGA AACCAATATT TTCCCAACAA 541 GTTGGGAGCT CTCAGAGAGA TATCTCTTTG TTGTGGACCG TCTCATTGCA CTTGATGCTG 601 CAGAAGAGTT CTTTAAGCTT GCTCGTCGAA CTTACCCCAA GAAGCCTGGG GTTCCATGCC 661 TGGCAGATGG CCAGAAAGAA CTGCACTACC TTCCGTTTCC AAGTCCCTAC CCAACTTTCT 721 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 781 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 841 GTGGAAAGGA CGAGGTACGA ACAGCCTGCT CAAACAGACG CGTTAAGTCg acaatcaacc 901 tctggattac aaaatttgtg aaagatt