Transcript: Mouse NM_001005423.2

Mus musculus melanoregulin (Mreg), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mreg (381269)
Length:
2493
CDS:
197..841

Additional Resources:

NCBI RefSeq record:
NM_001005423.2
NBCI Gene record:
Mreg (381269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180903 GTCAGTGGTAACAATCCGTAT pLKO.1 287 CDS 100% 4.050 5.265 N Mreg n/a
2 TRCN0000180940 GAGACGAATCTTAGAGGACTT pLKO.1 520 CDS 100% 4.050 2.835 N Mreg n/a
3 TRCN0000196130 GCATCGAGAAAGGAAGGCTAA pLKO.1 1044 3UTR 100% 4.050 2.835 N Mreg n/a
4 TRCN0000195844 CTCTCTGTTGTCAGTGACCAA pLKO.1 562 CDS 100% 2.640 1.848 N Mreg n/a
5 TRCN0000179435 GAATGGCAAAGACTCAACTAT pLKO.1 452 CDS 100% 5.625 3.375 N Mreg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03630 pDONR223 100% 84.6% 85.9% None (many diffs) n/a
2 ccsbBroad304_03630 pLX_304 0% 84.6% 85.9% V5 (many diffs) n/a
3 TRCN0000478538 GGTACGAACAGCCTGCTCAAACAG pLX_317 53.1% 84.6% 85.9% V5 (many diffs) n/a
Download CSV