Transcript: Human NM_001372188.1

Homo sapiens melanoregulin (MREG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-23
Taxon:
Homo sapiens (human)
Gene:
MREG (55686)
Length:
3298
CDS:
225..1019

Additional Resources:

NCBI RefSeq record:
NM_001372188.1
NBCI Gene record:
MREG (55686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001372188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134266 GCAGAAGCTCAACTATGATAT pLKO.1 635 CDS 100% 13.200 9.240 N MREG n/a
2 TRCN0000138896 GAGTGGCAGAAGCTCAACTAT pLKO.1 630 CDS 100% 5.625 3.938 N MREG n/a
3 TRCN0000134842 CAAGAGATCATGGTTCATGTT pLKO.1 2620 3UTR 100% 4.950 3.465 N MREG n/a
4 TRCN0000134495 GACCAATTTAACTGCTGTGTT pLKO.1 2881 3UTR 100% 4.950 3.465 N MREG n/a
5 TRCN0000133942 CATATTCCTCATTTGGAGCAA pLKO.1 331 CDS 100% 2.640 1.848 N MREG n/a
6 TRCN0000138408 CATTCGTAATCAGCAGGCCAA pLKO.1 449 CDS 100% 2.160 1.512 N MREG n/a
7 TRCN0000134116 CCTTCTTCTCTTCAGAAGATA pLKO.1 2499 3UTR 100% 0.563 0.394 N MREG n/a
8 TRCN0000138218 CTTGCACATATGCAGGGAGTA pLKO.1 2455 3UTR 100% 0.000 0.000 N MREG n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1700 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1690 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1625 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2280 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1697 3UTR 100% 4.950 2.475 Y LOC339059 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2280 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03630 pDONR223 100% 81% 81% None 254_403del n/a
2 ccsbBroad304_03630 pLX_304 0% 81% 81% V5 254_403del n/a
3 TRCN0000478538 GGTACGAACAGCCTGCTCAAACAG pLX_317 53.1% 81% 81% V5 254_403del n/a
Download CSV