Construct: ORF TRCN0000478544
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012072.1_s317c1
- Derived from:
- ccsbBroadEn_12088
- DNA Barcode:
- ACTGTCGAGCCAGCGCCAAATCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GATAD2A (54815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478544
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_024451560.1 | 90.4% | 90.4% | 774_929del |
2 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_024451558.1 | 82.4% | 82.4% | 1_156del;930_1085del |
3 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_024451559.1 | 82.4% | 82.4% | 1_156del;930_1085del |
4 | human | 54815 | GATAD2A | GATA zinc finger domain con... | NM_017660.4 | 77.4% | 77.4% | 1_429del |
5 | human | 54815 | GATAD2A | GATA zinc finger domain con... | NM_001300946.2 | 77.2% | 77.2% | 1_429del;1203_1205delAGC |
6 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_011528105.2 | 77.2% | 77.2% | 1_429del;1203_1205delAGC |
7 | human | 54815 | GATAD2A | GATA zinc finger domain con... | NM_001359631.1 | 73.3% | 73.3% | 1_429del;1203_1205delAGC;1500_1501ins75 |
8 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026903.1 | 71.5% | 71.5% | 1_429del;1203_1358del |
9 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026904.1 | 71.5% | 71.5% | 1_429del;1203_1358del |
10 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026905.2 | 71.5% | 71.5% | 1_429del;1203_1358del |
11 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026910.1 | 71.5% | 71.5% | 1_429del;1203_1358del |
12 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026902.1 | 69.6% | 69.6% | 1_486del;1260_1415del |
13 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026907.1 | 69.6% | 69.6% | 1_486del;1260_1415del |
14 | human | 54815 | GATAD2A | GATA zinc finger domain con... | XM_017026901.1 | 67.8% | 67.8% | 1_429del;1203_1358del;1653_1654ins75 |
15 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312719.1 | 65.8% | 70.5% | (many diffs) |
16 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | NM_145596.4 | 65.7% | 70.4% | (many diffs) |
17 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | NM_001113346.1 | 65.5% | 70.3% | (many diffs) |
18 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_011242295.2 | 65.5% | 70.3% | (many diffs) |
19 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_006509636.3 | 65.5% | 70.2% | (many diffs) |
20 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312718.1 | 65.4% | 70.2% | (many diffs) |
21 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312714.1 | 65.4% | 70.1% | (many diffs) |
22 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312715.1 | 65.4% | 70.1% | (many diffs) |
23 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312716.1 | 65.4% | 70.1% | (many diffs) |
24 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312717.1 | 65.4% | 70.1% | (many diffs) |
25 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312720.1 | 62.2% | 67.1% | (many diffs) |
26 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312722.1 | 62.2% | 67% | (many diffs) |
27 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_017312721.1 | 62.1% | 66.9% | (many diffs) |
28 | mouse | 234366 | Gatad2a | GATA zinc finger domain con... | XM_006509638.3 | 62% | 66.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1536
- ORF length:
- 1470
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat caagcagctg aaggaagaat tgaggttaga agaagcaaaa ctcgtgttgt 121 tgaaaaagtt gcggcagagt caaatacaaa aggaagccac cgcccagaag cccacaggtt 181 ctgttgggag caccgtgacc acccctcccc cgcttgttcg gggcactcag aacattcctg 241 ctggcaagcc atcactccag acctcttcag ctcggatgcc cggcagtgtc atacccccgc 301 ccctggtccg aggtgggcag caggcgtcct cgaagctggg gccacaggcg agctcacagg 361 tcgtcatgcc cccactcgtc aggggggctc agcaaatcca cagcattagg caacattcca 421 gcacagggcc accgcccctc ctcctggccc cccgggcgtc ggtgcccagt gtgcagattc 481 agggacagag gatcatccag cagggcctca tccgcgtcgc caatgttccc aacaccagcc 541 tgctcgtcaa catcccacag cccaccccag catcactgaa ggggacaaca gccacctccg 601 ctcaggccaa ctccaccccc actagtgtgg cctctgtggt cacctctgcc gagtctccag 661 caagccgaca ggcggccgcc aagctggcgc tgcgcaaaca gctggagaag acgctactcg 721 agatcccccc acccaagccc ccagccccag agatgaactt cctgcccagc gccgccaaca 781 acgagttcat ctacctggtc ggcctggagg aggtggtgca gaacctactg gagacacaag 841 gcaggatgtc ggccgccact gtgctgtccc gggagcccta catgtgtgca cagtgcaaga 901 cggacttcac gtgccgctgg cgggaggaga agagcggcgc catcatgtgt gagaactgca 961 tgacaaccaa ccagaagaag gcgctcaagg tggagcacac cagccggctg aaggccgcct 1021 ttgtgaaggc gctgcagcag gaacaggaga ttgagcagcg gctcctgcag cagggcacgg 1081 cccctgcaca ggccaaggcc gagcccaccg ctgccccaca ccccgtgctg aagcaggtca 1141 taaaaccccg gcgtaagttg gcgttccgct caggagaggc ccgcgactgg agtaacgggg 1201 ctgtgcTACA GGCCTCCAGC CAGCTGTCCC GGGGTTCGGC CACGACGCCC CGAGGTGTCC 1261 TGCACACGTT CAGTCCGTCA CCCAAACTGC AGAACTCAGC CTCGGCCACA GCCCTGGTCA 1321 GCAGGACCGG CAGACATTCT GAGAGAACCG TGAGCGCCGG CAAGGGCAGC GCCACCTCCA 1381 ACTGGAAGAA GACGCCCCTC AGCACAGGCG GGACCCTTGC GTTTGTCAGC CCAAGCCTGG 1441 CGGTGCACAA GAGCTCCTCG GCCGTGGACC GCCAGCGAGA GTACCTCCTG GACATGATCC 1501 CACCCCGCTC CATCCCCCAG TCAGCCACGT GGAAATACAC CACTTTCTTG TACAAAGTGG 1561 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1621 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1681 AACTGTCGAG CCAGCGCCAA ATCACACGCG TTAAGTCgac aatcaacctc tggattacaa 1741 aatttgtgaa agatt