Transcript: Mouse NM_001113346.1

Mus musculus GATA zinc finger domain containing 2A (Gatad2a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gatad2a (234366)
Length:
5062
CDS:
398..2287

Additional Resources:

NCBI RefSeq record:
NM_001113346.1
NBCI Gene record:
Gatad2a (234366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348689 CAGACCTCCTCCACTCGAATA pLKO_005 1007 CDS 100% 10.800 15.120 N Gatad2a n/a
2 TRCN0000124481 GCACCCTTGAACCTGACCTAA pLKO.1 435 CDS 100% 4.950 6.930 N Gatad2a n/a
3 TRCN0000124480 GCCGCCTTTGTGAAGGCTCTA pLKO.1 1769 CDS 100% 0.135 0.108 N Gatad2a n/a
4 TRCN0000376883 CCAATCAGCCACATGGAAATA pLKO_005 2266 CDS 100% 13.200 9.240 N Gatad2a n/a
5 TRCN0000124479 CCTCCTAATAAAGGCTCATTT pLKO.1 3448 3UTR 100% 13.200 9.240 N Gatad2a n/a
6 TRCN0000348688 GCCTCTTCATGGCCATCTATA pLKO_005 2668 3UTR 100% 13.200 9.240 N Gatad2a n/a
7 TRCN0000124483 GTGCTGCCAATAATGAGTTTA pLKO.1 1515 CDS 100% 13.200 9.240 N Gatad2a n/a
8 TRCN0000351731 GTGCTGCCAATAATGAGTTTA pLKO_005 1515 CDS 100% 13.200 9.240 N Gatad2a n/a
9 TRCN0000376961 TTGCTTCTGCTCAGGCAAATT pLKO_005 1338 CDS 100% 13.200 9.240 N Gatad2a n/a
10 TRCN0000348687 GATCATCCAGCAGGGACTTAT pLKO_005 1237 CDS 100% 13.200 7.920 N Gatad2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12088 pDONR223 100% 65.5% 70.3% None (many diffs) n/a
2 ccsbBroad304_12088 pLX_304 0% 65.5% 70.3% V5 (many diffs) n/a
3 TRCN0000478544 ACTGTCGAGCCAGCGCCAAATCAC pLX_317 22.8% 65.5% 70.3% V5 (many diffs) n/a
Download CSV