Transcript: Human XM_017026901.1

PREDICTED: Homo sapiens GATA zinc finger domain containing 2A (GATAD2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GATAD2A (54815)
Length:
5447
CDS:
7..1989

Additional Resources:

NCBI RefSeq record:
XM_017026901.1
NBCI Gene record:
GATAD2A (54815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015534 CCGGCAGACATTCTGAGAGAA pLKO.1 1778 CDS 100% 4.950 6.930 N GATAD2A n/a
2 TRCN0000015537 CCCTTGCGTTTGTCAGCCCAA pLKO.1 1865 CDS 100% 0.720 1.008 N GATAD2A n/a
3 TRCN0000274451 GATTGTTGGCTTCAGATTTAA pLKO_005 107 CDS 100% 15.000 10.500 N GATAD2A n/a
4 TRCN0000274452 GCCTTCCCATGGCGATCTATA pLKO_005 2458 3UTR 100% 13.200 9.240 N GATAD2A n/a
5 TRCN0000274450 CAGTCCTGAAGAACGAGAAAG pLKO_005 414 CDS 100% 10.800 7.560 N GATAD2A n/a
6 TRCN0000381477 CTCAGCAAATCCACAGCATTA pLKO_005 758 CDS 100% 10.800 7.560 N GATAD2A n/a
7 TRCN0000015536 TGCGGCAGAGTCAAATACAAA pLKO.1 500 CDS 100% 5.625 3.938 N GATAD2A n/a
8 TRCN0000274449 TGCGGCAGAGTCAAATACAAA pLKO_005 500 CDS 100% 5.625 3.938 N GATAD2A n/a
9 TRCN0000015535 CAGAACCTACTGGAGACACAA pLKO.1 1189 CDS 100% 4.950 3.465 N GATAD2A n/a
10 TRCN0000380181 GAACGAGAAAGGATGATCAAG pLKO_005 424 CDS 100% 4.950 3.465 N GATAD2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12088 pDONR223 100% 67.8% 67.8% None 1_429del;1203_1358del;1653_1654ins75 n/a
2 ccsbBroad304_12088 pLX_304 0% 67.8% 67.8% V5 1_429del;1203_1358del;1653_1654ins75 n/a
3 TRCN0000478544 ACTGTCGAGCCAGCGCCAAATCAC pLX_317 22.8% 67.8% 67.8% V5 1_429del;1203_1358del;1653_1654ins75 n/a
Download CSV