Construct: ORF TRCN0000478575
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008828.2_s317c1
- Derived from:
- ccsbBroadEn_05470
- DNA Barcode:
- ATATCCCCTTAAAGCAAATGACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TREML1 (340205)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478575
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 340205 | TREML1 | triggering receptor express... | NM_178174.3 | 100% | 100% | |
2 | human | 340205 | TREML1 | triggering receptor express... | XM_017010823.1 | 100% | 100% | |
3 | human | 340205 | TREML1 | triggering receptor express... | XM_017010824.1 | 100% | 100% | |
4 | human | 340205 | TREML1 | triggering receptor express... | XM_017010822.1 | 84% | 84% | 1_177del |
5 | human | 340205 | TREML1 | triggering receptor express... | NM_001271807.1 | 63.9% | 62% | 567_568ins53;597_598ins283 |
6 | human | 340205 | TREML1 | triggering receptor express... | NM_001271808.1 | 63% | 64.3% | (many diffs) |
7 | human | 340205 | TREML1 | triggering receptor express... | XM_017010825.1 | 53.7% | 52.1% | 1_177del;744_745ins53;774_775ins283 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1002
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggcctcacc ctgctcttgc tgctgctcct gggactagaa ggtcagggca 121 tagttggcag cctccctgag gtgctgcagg cacccgtggg aagctccatt ctggtgcagt 181 gccactacag gctccaggat gtcaaagctc agaaggtgtg gtgccggttc ttgccggagg 241 ggtgccagcc cctggtgtcc tcagctgtgg atcgcagagc tccagcgggc aggcgtacgt 301 ttctcacaga cctgggtggg ggcctgctgc aggtggaaat ggttaccctg caggaagagg 361 atgctggcga gtatggctgc atggtggatg gggccagggg gccccagatt ttgcacagag 421 tctctctgaa catactgccc ccagaggaag aagaagagac ccataagatt ggcagtctgg 481 ctgagaacgc attctcagac cctgcaggca gtgccaaccc tttggaaccc agccaggatg 541 agaagagcat ccccttgatc tggggtgctg tgctcctggt aggtctgctg gtggcagcgg 601 tggtgctgtt tgctgtgatg gccaagagga aacaagggaa caggcttggt gtctgtggcc 661 gattcctgag cagcagagtt tcaggcatga atccctccTC AGTGGTCCAC CACGTCAGTG 721 ACTCTGGACC GGCTGCTGAA TTGCCTTTGG ATGTACCACA CATTAGGCTT GACTCACCAC 781 CTTCATTTGA CAATACCACC TACACCAGCC TACCTCTTGA TTCCCCATCA GGAAAACCTT 841 CACTCCCAGC TCCATCCTCA TTGCCCCCTC TACCTCCTAA GGTCCTGGTC TGCTCCAAGC 901 CTGTGACATA TGCCACAGTA ATCTTCCCGG GAGGGAACAA GGGTGGAGGG ACCTCGTGTG 961 GGCCAGCCCA GAATCCACCT AACAATCAGA CTCCATCCAG CTTGCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGAATA TCCCCTTAAA GCAAATGACT TACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t