Transcript: Human NM_001271808.1

Homo sapiens triggering receptor expressed on myeloid cells like 1 (TREML1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TREML1 (340205)
Length:
1023
CDS:
62..664

Additional Resources:

NCBI RefSeq record:
NM_001271808.1
NBCI Gene record:
TREML1 (340205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416263 GAATCCACCTAACAATCAGAC pLKO_005 631 CDS 100% 4.050 5.670 N TREML1 n/a
2 TRCN0000060351 CACCACCTTCATTTGACAATA pLKO.1 435 CDS 100% 13.200 9.240 N TREML1 n/a
3 TRCN0000060352 CAGCAGAGTTTCAGGCATGAA pLKO.1 331 CDS 100% 4.950 3.465 N TREML1 n/a
4 TRCN0000060349 GCCTTTGGATGTACCACACAT pLKO.1 403 CDS 100% 4.950 3.465 N TREML1 n/a
5 TRCN0000423069 AGTCTGGCTGAGAACGCATTC pLKO_005 134 CDS 100% 6.000 3.600 N TREML1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05470 pDONR223 100% 63% 64.3% None (many diffs) n/a
2 ccsbBroad304_05470 pLX_304 0% 63% 64.3% V5 (many diffs) n/a
3 TRCN0000478575 ATATCCCCTTAAAGCAAATGACTT pLX_317 32.8% 63% 64.3% V5 (many diffs) n/a
Download CSV