Transcript: Human NM_178174.3

Homo sapiens triggering receptor expressed on myeloid cells like 1 (TREML1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TREML1 (340205)
Length:
1356
CDS:
62..997

Additional Resources:

NCBI RefSeq record:
NM_178174.3
NBCI Gene record:
TREML1 (340205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416263 GAATCCACCTAACAATCAGAC pLKO_005 964 CDS 100% 4.050 5.670 N TREML1 n/a
2 TRCN0000424271 CTAGAAGGTCAGGGCATAGTT pLKO_005 98 CDS 100% 5.625 4.500 N TREML1 n/a
3 TRCN0000060351 CACCACCTTCATTTGACAATA pLKO.1 768 CDS 100% 13.200 9.240 N TREML1 n/a
4 TRCN0000060352 CAGCAGAGTTTCAGGCATGAA pLKO.1 664 CDS 100% 4.950 3.465 N TREML1 n/a
5 TRCN0000060348 CCAGGATGTCAAAGCTCAGAA pLKO.1 187 CDS 100% 4.950 3.465 N TREML1 n/a
6 TRCN0000060350 GCACAGAGTCTCTCTGAACAT pLKO.1 406 CDS 100% 4.950 3.465 N TREML1 n/a
7 TRCN0000060349 GCCTTTGGATGTACCACACAT pLKO.1 736 CDS 100% 4.950 3.465 N TREML1 n/a
8 TRCN0000423069 AGTCTGGCTGAGAACGCATTC pLKO_005 467 CDS 100% 6.000 3.600 N TREML1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05470 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05470 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478575 ATATCCCCTTAAAGCAAATGACTT pLX_317 32.8% 100% 100% V5 n/a
Download CSV