Construct: ORF TRCN0000478589
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010570.2_s317c1
- Derived from:
- ccsbBroadEn_09621
- DNA Barcode:
- TATTTCTGCCGGAAGTATATCAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTGR2 (145482)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478589
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001146154.2 | 99.9% | 100% | 228A>T |
2 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001146155.3 | 99.9% | 100% | 228A>T |
3 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371325.1 | 99.9% | 100% | 228A>T |
4 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_152444.4 | 99.9% | 100% | 228A>T |
5 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371326.1 | 83.6% | 83.7% | 228A>T;346_347ins171 |
6 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371327.1 | 79.9% | 80% | 228A>T;516_517ins210 |
7 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371328.1 | 79.9% | 80% | 228A>T;516_517ins210 |
8 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371329.1 | 79.9% | 80% | 228A>T;516_517ins210 |
9 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371330.1 | 61.8% | 61.8% | 0_1ins402 |
10 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371331.1 | 61.8% | 61.8% | 0_1ins402 |
11 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371332.1 | 61.8% | 61.8% | 0_1ins402 |
12 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371334.1 | 34% | 33.3% | (many diffs) |
13 | human | 145482 | PTGR2 | prostaglandin reductase 2 | NM_001371335.1 | 16.6% | 15.1% | (many diffs) |
14 | mouse | 77219 | Ptgr2 | prostaglandin reductase 2 | NM_001252625.1 | 85.4% | 86.6% | (many diffs) |
15 | mouse | 77219 | Ptgr2 | prostaglandin reductase 2 | NM_029880.3 | 85.4% | 86.6% | (many diffs) |
16 | mouse | 77219 | Ptgr2 | prostaglandin reductase 2 | NM_001252626.1 | 72.9% | 73.5% | (many diffs) |
17 | mouse | 77219 | Ptgr2 | prostaglandin reductase 2 | XM_006516369.1 | 70.5% | 71.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1119
- ORF length:
- 1053
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat tgttcaaaga gtggtattga attctcgacc tggaaaaaat ggtaatccag 121 tggcagagaa tttccgaatg gaagaagtct atttaccaga taatattaat gaaggacaag 181 tacaagttag aactctttat ctttctgtgg atccttacat gcgttgtaga atgaatgaag 241 acactggcac tgattatata acaccttggc agctatctca agtcgttgat ggtggaggta 301 ttggaattat agaagaaagc aaacacacaa atttgactaa aggcgatttt gtgacttctt 361 tctattggcc ctggcaaacc aaggttattc tggatggaaa tagccttgaa aaggtagacc 421 cacaacttgt ggatggacac ctttcatatt ttcttggagc tataggtatg cctggtttga 481 cttccttgat tgggatacag gaaaaaggtc atataactgc tggatctaat aagacaatgg 541 ttgtcagtgg ggccgcaggt gcctgtggat ctgtggctgg gcagattggc catttcttag 601 gttgttccag agtggtggga atttgtggaa cacatgagaa atgcatcctc ttgacctcag 661 aactgggctt tgatgctgca attaattata aaaaagacaa tgtggcagaa cagctccgtg 721 aatcatgccc agctggagtg gatgtttatt ttgacaatgt tggtggtaac atcagtgata 781 cagtgataag tcagatgaat gagaacagcc acatcatcct gtgtggtcaa atttctcagt 841 acaacaaaga tgtgccttaT CCTCCCCCGC TATCCCCTGC TATAGAGGCA ATCCAGAAAG 901 AAAGAAACAT CACAAGGGAA AGATTTCTGG TATTAAATTA TAAAGACAAA TTTGAGCCTG 961 GCATTCTACA GCTGAGTCAG TGGTTTAAAG AAGGAAAGCT AAAGATTAAA GAGACGGTAA 1021 TAAATGGGTT GGAAAACATG GGAGCTGCAT TCCAGTCCAT GATGACAGGA GGTAACATTG 1081 GAAAGCAGAT AGTTTGCATT TCAGAAGAAA TCTCTTTGTA CCCAACTTTC TTGTACAAAG 1141 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1201 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1261 ACGATATTTC TGCCGGAAGT ATATCAAGAC GCGTTAAGTC gacaatcaac ctctggatta 1321 caaaatttgt gaaagatt