Transcript: Mouse NM_001252625.1

Mus musculus prostaglandin reductase 2 (Ptgr2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ptgr2 (77219)
Length:
3178
CDS:
287..1342

Additional Resources:

NCBI RefSeq record:
NM_001252625.1
NBCI Gene record:
Ptgr2 (77219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183562 GAGAGAGATTTACGGTATTAA pLKO.1 1137 CDS 100% 15.000 21.000 N Ptgr2 n/a
2 TRCN0000345307 GAGAGAGATTTACGGTATTAA pLKO_005 1137 CDS 100% 15.000 21.000 N Ptgr2 n/a
3 TRCN0000180686 GCCATATATCTGCTGGATCTA pLKO.1 729 CDS 100% 4.950 6.930 N Ptgr2 n/a
4 TRCN0000345235 GCCATATATCTGCTGGATCTA pLKO_005 729 CDS 100% 4.950 6.930 N Ptgr2 n/a
5 TRCN0000183880 CCTGGCTTGACTTCCTTGATT pLKO.1 692 CDS 100% 5.625 3.938 N Ptgr2 n/a
6 TRCN0000345304 CCTGGCTTGACTTCCTTGATT pLKO_005 692 CDS 100% 5.625 3.938 N Ptgr2 n/a
7 TRCN0000183344 GATGTCTACTTTGACAATGTT pLKO.1 962 CDS 100% 5.625 3.938 N Ptgr2 n/a
8 TRCN0000180956 GAATGAGAACAGCCACATCAT pLKO.1 1018 CDS 100% 4.950 3.465 N Ptgr2 n/a
9 TRCN0000345306 GAATGAGAACAGCCACATCAT pLKO_005 1018 CDS 100% 4.950 3.465 N Ptgr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09621 pDONR223 100% 85.4% 86.6% None (many diffs) n/a
2 ccsbBroad304_09621 pLX_304 0% 85.4% 86.6% V5 (many diffs) n/a
3 TRCN0000478589 TATTTCTGCCGGAAGTATATCAAG pLX_317 25.1% 85.4% 86.6% V5 (many diffs) n/a
Download CSV