Transcript: Human NM_001371335.1

Homo sapiens prostaglandin reductase 2 (PTGR2), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
PTGR2 (145482)
Length:
1223
CDS:
161..352

Additional Resources:

NCBI RefSeq record:
NM_001371335.1
NBCI Gene record:
PTGR2 (145482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220886 CGAATGGAAGAAGTCTATTTA pLKO.1 230 CDS 100% 15.000 10.500 N PTGR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09621 pDONR223 100% 16.6% 15.1% None (many diffs) n/a
2 ccsbBroad304_09621 pLX_304 0% 16.6% 15.1% V5 (many diffs) n/a
3 TRCN0000478589 TATTTCTGCCGGAAGTATATCAAG pLX_317 25.1% 16.6% 15.1% V5 (many diffs) n/a
Download CSV