Construct: ORF TRCN0000478598
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005143.1_s317c1
- Derived from:
- ccsbBroadEn_10686
- DNA Barcode:
- TTCCGTTAGTTTTGATGTCCCCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SERPINC1 (462)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478598
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 462 | SERPINC1 | serpin family C member 1 | NM_000488.3 | 55.8% | 55.8% | 560_1174del |
| 2 | human | 462 | SERPINC1 | serpin family C member 1 | NM_001365052.1 | 45.4% | 45.4% | 0_1ins144;416_1030del |
| 3 | mouse | 11905 | Serpinc1 | serine (or cysteine) peptid... | NM_080844.4 | 47.5% | 49% | (many diffs) |
| 4 | mouse | 11905 | Serpinc1 | serine (or cysteine) peptid... | XM_006496626.2 | 47.5% | 49% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 843
- ORF length:
- 777
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta ttccaatgtg ataggaactg taacctctgg aaaaaggaag gtttatcttt 121 tgtccttgct gctcattggc ttctgggact gcgtgacctg tcacgggagc cctgtggaca 181 tctgcacagc caagccgcgg gacattccca tgaatcccat gtgcatttac cgctccccgg 241 agaagaaggc aactgaggat gagggctcag aacagaagat cccggaggcc accaaccggc 301 gtgtctggga actgtccaag gccaattccc gctttgctac cactttctat cagcacctgg 361 cagattccaa gaatgacaat gataacattt tcctgtcacc cctgagtatc tccacggctt 421 ttgctatgac caagctgggt gcctgtaatg acaccctcca gcaactgatg gaggtattta 481 agtttgacac catatctgag aaaacatctg atcagatcca cttcttcttt gccaaactga 541 actgccgact ctatcgaaaa gccaacaaat cctccaagtt agtatcagcc aatcgccttt 601 ttggagacaa atcccTTACC TTCAATGACC TCTATGTCTC AGATGCATTC CATAAGGCAT 661 TTCTTGAGGT AAATGAAGAA GGCAGTGAAG CAGCTGCAAG TACCGCTGTT GTGATTGCTG 721 GCCGTTCGCT AAACCCCAAC AGGGTGACTT TCAAGGCCAA CAGGCCTTTC CTGGTTTTTA 781 TAAGAGAAGT TCCTCTGAAC ACTATTATCT TCATGGGCAG AGTAGCCAAC CCTTGTGTTA 841 AGTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGATT CCGTTAGTTT TGATGTCCCC TAACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt