Transcript: Human NM_000488.3

Homo sapiens serpin family C member 1 (SERPINC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SERPINC1 (462)
Length:
1599
CDS:
120..1514

Additional Resources:

NCBI RefSeq record:
NM_000488.3
NBCI Gene record:
SERPINC1 (462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006713 GCCAACAAATCCTCCAAGTTA pLKO.1 615 CDS 100% 5.625 7.875 N SERPINC1 n/a
2 TRCN0000373508 GCCGAATCACCGATGTCATTC pLKO_005 802 CDS 100% 10.800 8.640 N SERPINC1 n/a
3 TRCN0000373445 GACATCAGTGAGTTGGTATAT pLKO_005 693 CDS 100% 13.200 9.240 N SERPINC1 n/a
4 TRCN0000006715 CCGCTTTGCTACCACTTTCTA pLKO.1 383 CDS 100% 5.625 3.938 N SERPINC1 n/a
5 TRCN0000006716 GCATTCCATAAGGCATTTCTT pLKO.1 1314 CDS 100% 5.625 3.938 N SERPINC1 n/a
6 TRCN0000006717 CCCATGAATCCCATGTGCATT pLKO.1 261 CDS 100% 4.950 3.465 N SERPINC1 n/a
7 TRCN0000006714 GCTGGATGAATTGGAGGAGAT pLKO.1 1136 CDS 100% 4.050 2.835 N SERPINC1 n/a
8 TRCN0000080066 CCTGAGAACACAAGGAAGGAA pLKO.1 906 CDS 100% 3.000 2.100 N Serpinc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10686 pDONR223 100% 55.8% 55.8% None 560_1174del n/a
2 ccsbBroad304_10686 pLX_304 0% 55.8% 55.8% V5 560_1174del n/a
3 TRCN0000478598 TTCCGTTAGTTTTGATGTCCCCTA pLX_317 29.8% 55.8% 55.8% V5 560_1174del n/a
Download CSV