Transcript: Mouse NM_080844.4

Mus musculus serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 (Serpinc1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Serpinc1 (11905)
Length:
2171
CDS:
213..1610

Additional Resources:

NCBI RefSeq record:
NM_080844.4
NBCI Gene record:
Serpinc1 (11905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080844.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080064 CGACGCATTCCACAAAGCATT pLKO.1 1406 CDS 100% 4.950 6.930 N Serpinc1 n/a
2 TRCN0000080063 CCATGTCTCAAGATGGTCTTT pLKO.1 1869 3UTR 100% 4.950 3.960 N Serpinc1 n/a
3 TRCN0000080065 CTGTGCTATCTGTCACGGAAA pLKO.1 296 CDS 100% 4.050 3.240 N Serpinc1 n/a
4 TRCN0000080067 AGTTGCACTGAACACTATTAT pLKO.1 1553 CDS 100% 15.000 9.000 N Serpinc1 n/a
5 TRCN0000080066 CCTGAGAACACAAGGAAGGAA pLKO.1 1002 CDS 100% 3.000 1.800 N Serpinc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080844.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10686 pDONR223 100% 47.5% 49% None (many diffs) n/a
2 ccsbBroad304_10686 pLX_304 0% 47.5% 49% V5 (many diffs) n/a
3 TRCN0000478598 TTCCGTTAGTTTTGATGTCCCCTA pLX_317 29.8% 47.5% 49% V5 (many diffs) n/a
Download CSV