Construct: ORF TRCN0000478607
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012827.2_s317c1
- Derived from:
- ccsbBroadEn_07756
- DNA Barcode:
- GGAGTACAAGATCACTGTTGCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCAN3 (11123)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478607
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251977.2 | 99.5% | 100% | 414G>A;462G>A;663G>A |
| 2 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251978.1 | 99.5% | 100% | 414G>A;462G>A;663G>A |
| 3 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251979.2 | 99.5% | 100% | 414G>A;462G>A;663G>A |
| 4 | human | 11123 | RCAN3 | RCAN family member 3 | NM_013441.4 | 99.5% | 100% | 414G>A;462G>A;663G>A |
| 5 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251980.1 | 95.4% | 95.8% | (many diffs) |
| 6 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251981.1 | 75.5% | 75.9% | (many diffs) |
| 7 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251982.1 | 71.6% | 55.1% | 366_367ins172;491G>A;519_520ins32 |
| 8 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251983.1 | 47.7% | 48.1% | (many diffs) |
| 9 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251984.1 | 47.7% | 48.1% | (many diffs) |
| 10 | human | 11123 | RCAN3 | RCAN family member 3 | NM_001251985.1 | 47.5% | 32.3% | 193_194ins346;317G>A;345_346ins32 |
| 11 | mouse | 53902 | Rcan3 | regulator of calcineurin 3 | NM_022980.4 | 80.4% | 89.6% | (many diffs) |
| 12 | mouse | 53902 | Rcan3 | regulator of calcineurin 3 | XM_017320317.1 | 80.4% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 789
- ORF length:
- 723
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gagggacact atgaaatctt ggaatgatag ccagtcagat ctgtgtagca 121 ctgaccaaga agaggaagaa gagatgattt ttggtgaaaa tgaagatgat ttggatgaga 181 tgatggattt aagtgatctg cctacctcac tttttgcttg cagcgtccat gaagcagtgt 241 ttgaggcacg agagcagaag gaaagatttg aagcactctt caccatctat gatgaccagg 301 ttacttttca gctgtttaaa agctttagaa gagtcagaat aaatttcagc aaacctgaag 361 cggcagcaag agcgcgaata gaactccacg aaacagactt caatgggcag aagctaaagc 421 tatattttgc acaggtgcag atgtccggcg aagtgcggga caagtcctat cTCCTGCCAC 481 CCCAGCCTGT CAAGCAGTTC CTCATCTCCC CTCCAGCCTC TCCCCCAGTG GGGTGGAAGC 541 AGAGCGAAGA TGCGATGCCT GTTATAAATT ATGATTTACT CTGTGCTGTT TCCAAATTGG 601 GACCAGGAGA GAAATATGAA CTTCACGCGG GAACAGAGTC GACACCCAGC GTGGTGGTTC 661 ATGTCTGTGA AAGTGAAACT GAAGAGGAAG AAGAGACAAA AAACCCCAAA CAGAAAATTG 721 CCCAGACAAG GCGCCCCGAC CCTCCGACCG CAGCGTTGAA TGAGCCCCAG ACCTTTGATT 781 GCGCGCTGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 841 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 901 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGGAGTA CAAGATCACT GTTGCGGCAC 961 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt