Transcript: Human NM_001251977.2

Homo sapiens RCAN family member 3 (RCAN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RCAN3 (11123)
Length:
6830
CDS:
342..1067

Additional Resources:

NCBI RefSeq record:
NM_001251977.2
NBCI Gene record:
RCAN3 (11123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149270 GAAGATGCGATGCCTGTTATA pLKO.1 822 CDS 100% 13.200 10.560 N RCAN3 n/a
2 TRCN0000343055 GAAGATGCGATGCCTGTTATA pLKO_005 822 CDS 100% 13.200 10.560 N RCAN3 n/a
3 TRCN0000148767 CGAATAGAACTCCACGAAACA pLKO.1 651 CDS 100% 4.950 3.960 N RCAN3 n/a
4 TRCN0000343127 CGAATAGAACTCCACGAAACA pLKO_005 651 CDS 100% 4.950 3.960 N RCAN3 n/a
5 TRCN0000147311 GATTTGGATGAGATGATGGAT pLKO.1 444 CDS 100% 3.000 2.100 N RCAN3 n/a
6 TRCN0000343126 GATTTGGATGAGATGATGGAT pLKO_005 444 CDS 100% 3.000 2.100 N RCAN3 n/a
7 TRCN0000149551 GCACTCTTCACCATCTATGAT pLKO.1 549 CDS 100% 5.625 3.375 N RCAN3 n/a
8 TRCN0000147103 CCAGGAGAGAAATATGAACTT pLKO.1 879 CDS 100% 4.950 2.970 N RCAN3 n/a
9 TRCN0000343056 CCAGGAGAGAAATATGAACTT pLKO_005 879 CDS 100% 4.950 2.970 N RCAN3 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3494 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4319 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07756 pDONR223 100% 99.5% 100% None 414G>A;462G>A;663G>A n/a
2 ccsbBroad304_07756 pLX_304 0% 99.5% 100% V5 414G>A;462G>A;663G>A n/a
3 TRCN0000478607 GGAGTACAAGATCACTGTTGCGGC pLX_317 44.1% 99.5% 100% V5 414G>A;462G>A;663G>A n/a
Download CSV