Transcript: Human NM_001251984.1

Homo sapiens RCAN family member 3 (RCAN3), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RCAN3 (11123)
Length:
2392
CDS:
294..644

Additional Resources:

NCBI RefSeq record:
NM_001251984.1
NBCI Gene record:
RCAN3 (11123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149270 GAAGATGCGATGCCTGTTATA pLKO.1 399 CDS 100% 13.200 10.560 N RCAN3 n/a
2 TRCN0000343055 GAAGATGCGATGCCTGTTATA pLKO_005 399 CDS 100% 13.200 10.560 N RCAN3 n/a
3 TRCN0000148767 CGAATAGAACTCCACGAAACA pLKO.1 228 5UTR 100% 4.950 3.960 N RCAN3 n/a
4 TRCN0000343127 CGAATAGAACTCCACGAAACA pLKO_005 228 5UTR 100% 4.950 3.960 N RCAN3 n/a
5 TRCN0000149551 GCACTCTTCACCATCTATGAT pLKO.1 126 5UTR 100% 5.625 3.375 N RCAN3 n/a
6 TRCN0000147103 CCAGGAGAGAAATATGAACTT pLKO.1 456 CDS 100% 4.950 2.970 N RCAN3 n/a
7 TRCN0000343056 CCAGGAGAGAAATATGAACTT pLKO_005 456 CDS 100% 4.950 2.970 N RCAN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07756 pDONR223 100% 47.7% 48.1% None (many diffs) n/a
2 ccsbBroad304_07756 pLX_304 0% 47.7% 48.1% V5 (many diffs) n/a
3 TRCN0000478607 GGAGTACAAGATCACTGTTGCGGC pLX_317 44.1% 47.7% 48.1% V5 (many diffs) n/a
Download CSV