Construct: ORF TRCN0000478629
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004952.1_s317c1
- Derived from:
- ccsbBroadEn_08293
- DNA Barcode:
- TCATGCCTTCACCTGTGAATGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IP6K2 (51447)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478629
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001005909.2 | 99.9% | 99.7% | 499G>T |
| 2 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_016291.4 | 99.9% | 99.7% | 499G>T |
| 3 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006583.2 | 99.9% | 99.7% | 499G>T |
| 4 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006584.2 | 99.9% | 99.7% | 499G>T |
| 5 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006585.2 | 99.9% | 99.7% | 499G>T |
| 6 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453568.1 | 99.9% | 99.7% | 499G>T |
| 7 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453569.1 | 99.9% | 99.7% | 499G>T |
| 8 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453570.1 | 99.9% | 99.7% | 499G>T |
| 9 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453571.1 | 99.9% | 99.7% | 499G>T |
| 10 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_006713202.2 | 88.6% | 88.5% | 1_162del;661G>T |
| 11 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_011533816.2 | 88.6% | 88.5% | 1_162del;661G>T |
| 12 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_006713201.2 | 88.4% | 88.3% | 1_165del;664G>T |
| 13 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_011533817.2 | 88.3% | 85.6% | (many diffs) |
| 14 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_011533818.1 | 88.3% | 85.6% | (many diffs) |
| 15 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006587.2 | 88.3% | 85.6% | (many diffs) |
| 16 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453572.1 | 88.3% | 85.6% | (many diffs) |
| 17 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453573.1 | 88.3% | 85.6% | (many diffs) |
| 18 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453574.1 | 88.3% | 85.6% | (many diffs) |
| 19 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453575.1 | 88.3% | 85.6% | (many diffs) |
| 20 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453576.1 | 88.3% | 85.6% | (many diffs) |
| 21 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453577.1 | 88.3% | 85.6% | (many diffs) |
| 22 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453578.1 | 88.3% | 85.6% | (many diffs) |
| 23 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453579.1 | 88.3% | 85.6% | (many diffs) |
| 24 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453580.1 | 88.3% | 85.6% | (many diffs) |
| 25 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453581.1 | 88.3% | 85.6% | (many diffs) |
| 26 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453582.1 | 88.3% | 85.6% | (many diffs) |
| 27 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453583.1 | 88.3% | 85.6% | (many diffs) |
| 28 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453584.1 | 88.3% | 85.6% | (many diffs) |
| 29 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453585.1 | 88.3% | 85.6% | (many diffs) |
| 30 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453586.1 | 88.3% | 85.6% | (many diffs) |
| 31 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453587.1 | 88.3% | 85.6% | (many diffs) |
| 32 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_024453588.1 | 88.3% | 85.6% | (many diffs) |
| 33 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_006713200.1 | 87.9% | 87.8% | 1_174del;673G>T |
| 34 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_006713199.4 | 87.7% | 87.6% | 1_177del;676G>T |
| 35 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001005910.3 | 19.9% | 16.5% | (many diffs) |
| 36 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001005911.3 | 19.9% | 16.5% | (many diffs) |
| 37 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006588.1 | 19.6% | 17% | (many diffs) |
| 38 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001190316.1 | 19.6% | 16.9% | (many diffs) |
| 39 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001190317.1 | 19.5% | 16.8% | (many diffs) |
| 40 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001146178.2 | 19.3% | 16.4% | (many diffs) |
| 41 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | NM_001146179.3 | 19.3% | 16.4% | (many diffs) |
| 42 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_011533822.1 | 19.3% | 16.4% | (many diffs) |
| 43 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_011533823.1 | 19.3% | 16.4% | (many diffs) |
| 44 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006591.1 | 17.6% | 14.6% | (many diffs) |
| 45 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006589.1 | 17.5% | 14.5% | (many diffs) |
| 46 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006590.2 | 17.5% | 14.5% | (many diffs) |
| 47 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006592.1 | 17% | 14.4% | (many diffs) |
| 48 | human | 51447 | IP6K2 | inositol hexakisphosphate k... | XM_017006593.1 | 17% | 14.4% | (many diffs) |
| 49 | mouse | 76500 | Ip6k2 | inositol hexaphosphate kina... | XM_006511852.2 | 91.7% | 96.4% | (many diffs) |
| 50 | mouse | 76500 | Ip6k2 | inositol hexaphosphate kina... | NM_029634.2 | 87% | 91.5% | (many diffs) |
| 51 | mouse | 76500 | Ip6k2 | inositol hexaphosphate kina... | XM_006511850.2 | 87% | 91.5% | (many diffs) |
| 52 | mouse | 76500 | Ip6k2 | inositol hexaphosphate kina... | XM_006511851.3 | 87% | 91.5% | (many diffs) |
| 53 | mouse | 76500 | Ip6k2 | inositol hexaphosphate kina... | XM_006511856.3 | 17.1% | 16.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1344
- ORF length:
- 1278
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cccagccttc agggccatgg atgtggagcc ccgcgccaaa ggcgtccttc 121 tggagccctt tgtccaccag gtcggggggc actcatgcgt gctccgcttc aatgagacaa 181 ccctgtgcaa gcccctggtc ccaagggaac atcagttcta cgagaccctc cctgctgaga 241 tgcgcaaatt cactccccag tacaaaggtg tggtatctgt gcgctttgaa gaagatgaag 301 acaggaactt gtgtctaata gcatatccat tgaaagggga ccatggaatt gtggacattg 361 tagataattc agactgtgaa ccaaaaagta agctcctaag gtggacaaca aacaaaaaac 421 atcatgtctt agaaacagaa aagaccccta aggactgggt gcgtcagcac cgtaaagagg 481 agaaaatgaa gagccataag ttagaagaag aatttgagtg gctaaagaaa tctgaagtct 541 tgtactacac tgtagagaag aagtggaata taagttccca gcttaaacac tataaccctt 601 ggagcatgaa atgtcaccag caacagttac agagaatgaa ggagaatgca aagcatcgga 661 accagtacaa atttatctta ctggaaaacc tgacttcccg ctacgaggtg ccttgtgtcc 721 ttgacctcaa gatgggcaca cgacaacatg gtgatgatgc ttcagaggag aaggcagcca 781 accagatccg aaaatgtcag cagagcacat ctgcagtcat tggtgtgcgt gtgtgtggca 841 tgcaggtgta ccaagcaggc agtgggcagc tcatgttcat gaacaagtac catggacgga 901 agctatcggt gcagggcttc aaggaggcac ttttccagtt cttccacaat gggcggtacc 961 tgcgccgtga actccTGGGC CCTGTGCTCA AGAAGCTGAC TGAGCTCAAG GCAGTGTTGG 1021 AGCGACAGGA GTCCTACCGC TTCTACTCAA GCTCCCTGCT GGTCATTTAT GATGGCAAGG 1081 AGCGGCCCGA AGTGGTCCTG GACTCAGATG CTGAGGATTT GGAGGACCTG TCAGAGGAAT 1141 CAGCTGATGA GTCTGCTGGT GCCTATGCCT ACAAACCCAT CGGCGCCAGC TCTGTAGATG 1201 TGCGCATGAT CGACTTTGCA CACACCACCT GCAGGCTGTA TGGCGAGGAC ACCGTGGTGC 1261 ATGAGGGCCA GGATGCTGGC TATATCTTCG GGCTCCAGAG CCTGATAGAC ATTGTCACAG 1321 AGATAAGTGA GGAGAGTGGG GAGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CATGCCTTCA 1501 CCTGTGAATG CCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1561 att