Transcript: Mouse XM_006511852.2

PREDICTED: Mus musculus inositol hexaphosphate kinase 2 (Ip6k2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ip6k2 (76500)
Length:
1809
CDS:
238..1515

Additional Resources:

NCBI RefSeq record:
XM_006511852.2
NBCI Gene record:
Ip6k2 (76500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191589 GCATCGAAACCAGTACAAATT pLKO.1 822 CDS 100% 13.200 18.480 N Ip6k2 n/a
2 TRCN0000195257 GTTCCCAGCTTAAACACTATA pLKO.1 743 CDS 100% 13.200 18.480 N IP6K2 n/a
3 TRCN0000350439 GTTCCCAGCTTAAACACTATA pLKO_005 743 CDS 100% 13.200 18.480 N IP6K2 n/a
4 TRCN0000006141 CCCAGTACAAAGGTGTGGTAT pLKO.1 428 CDS 100% 4.950 3.465 N IP6K2 n/a
5 TRCN0000202175 CAATGAGACAACCCTGTGCAA pLKO.1 342 CDS 100% 2.640 1.848 N Ip6k2 n/a
6 TRCN0000202257 GTTCTTTCACAATGGGCGGTA pLKO.1 1107 CDS 100% 2.160 1.512 N Ip6k2 n/a
7 TRCN0000202065 CCGATTCAATGAGACAACCCT pLKO.1 336 CDS 100% 0.750 0.525 N Ip6k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08292 pDONR223 100% 91.9% 96.7% None (many diffs) n/a
2 ccsbBroad304_08292 pLX_304 0% 91.9% 96.7% V5 (many diffs) n/a
3 ccsbBroadEn_15068 pDONR223 0% 91.9% 96.7% None (many diffs) n/a
4 ccsbBroad304_15068 pLX_304 0% 91.9% 96.7% V5 (many diffs) n/a
5 TRCN0000469002 TCGCCTTGAGGCGCCCCCCTGCCA pLX_317 30.3% 91.9% 96.7% V5 (many diffs) n/a
6 ccsbBroadEn_08293 pDONR223 100% 91.7% 96.4% None (many diffs) n/a
7 ccsbBroad304_08293 pLX_304 0% 91.7% 96.4% V5 (many diffs) n/a
8 TRCN0000478629 TCATGCCTTCACCTGTGAATGCCT pLX_317 29.1% 91.7% 96.4% V5 (many diffs) n/a
9 ccsbBroadEn_15842 pDONR223 0% 15.1% 15.2% None (many diffs) n/a
10 ccsbBroad304_15842 pLX_304 0% 15.1% 15.2% V5 (many diffs) n/a
11 TRCN0000492194 ATCCTCCCCCCGGAGATAATCTAT pLX_317 100% 15.1% 15.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV