Transcript: Human XM_006713199.4

PREDICTED: Homo sapiens inositol hexakisphosphate kinase 2 (IP6K2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IP6K2 (51447)
Length:
1901
CDS:
174..1631

Additional Resources:

NCBI RefSeq record:
XM_006713199.4
NBCI Gene record:
IP6K2 (51447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146075 GGACACAAGGCACCTCGTAG pXPR_003 CGG 815 56% 6 0.4639 IP6K2 IP6K2 77816
2 BRDN0001145795 CAAAAAGTAAGCTCCTAAGG pXPR_003 TGG 510 35% 4 0.0842 IP6K2 IP6K2 77817
3 BRDN0001145651 AATAGCATATCCATTGAAAG pXPR_003 GGG 445 31% 4 -0.1716 IP6K2 IP6K2 77819
4 BRDN0001145457 GGTGCGTCAGCACCGTAAAG pXPR_003 AGG 586 40% 4 -0.4347 IP6K2 IP6K2 77818
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315387 AGCATCGGAACCAGTACAAAT pLKO_005 937 CDS 100% 13.200 18.480 N IP6K2 n/a
2 TRCN0000006143 GCTCCTAAGGTGGACAACAAA pLKO.1 677 CDS 100% 5.625 7.875 N IP6K2 n/a
3 TRCN0000380652 AGCTCCCTGCTGGTCATTTAT pLKO_005 1335 CDS 100% 15.000 10.500 N IP6K2 n/a
4 TRCN0000382080 TTGTGGACATTGTAGATAATT pLKO_005 634 CDS 100% 15.000 10.500 N IP6K2 n/a
5 TRCN0000315337 CCCTGCTGAGATGCGCAAATT pLKO_005 515 CDS 100% 13.200 9.240 N IP6K2 n/a
6 TRCN0000195257 GTTCCCAGCTTAAACACTATA pLKO.1 859 CDS 100% 13.200 9.240 N IP6K2 n/a
7 TRCN0000350439 GTTCCCAGCTTAAACACTATA pLKO_005 859 CDS 100% 13.200 9.240 N IP6K2 n/a
8 TRCN0000006144 GCAACAGTTACAGAGAATGAA pLKO.1 905 CDS 100% 5.625 3.938 N IP6K2 n/a
9 TRCN0000195425 CCATGGAATTGTGGACATTGT pLKO.1 626 CDS 100% 4.950 3.465 N IP6K2 n/a
10 TRCN0000006141 CCCAGTACAAAGGTGTGGTAT pLKO.1 541 CDS 100% 4.950 3.465 N IP6K2 n/a
11 TRCN0000199807 GCTCTGTAGATGTGCGCATGA pLKO.1 1474 CDS 100% 4.050 2.835 N IP6K2 n/a
12 TRCN0000350514 GCTCTGTAGATGTGCGCATGA pLKO_005 1474 CDS 100% 4.050 2.835 N IP6K2 n/a
13 TRCN0000202175 CAATGAGACAACCCTGTGCAA pLKO.1 455 CDS 100% 2.640 1.848 N Ip6k2 n/a
14 TRCN0000199458 GCTTGCTAGCTGCTCCAGTAC pLKO.1 1632 CDS 100% 1.350 0.945 N IP6K2 n/a
15 TRCN0000006140 GCTGTGCTTGGAGTCTTTATT pLKO.1 1785 3UTR 100% 15.000 9.000 N IP6K2 n/a
16 TRCN0000350515 GCTGTGCTTGGAGTCTTTATT pLKO_005 1785 3UTR 100% 15.000 9.000 N IP6K2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08293 pDONR223 100% 87.7% 87.6% None 1_177del;676G>T n/a
2 ccsbBroad304_08293 pLX_304 0% 87.7% 87.6% V5 1_177del;676G>T n/a
3 TRCN0000478629 TCATGCCTTCACCTGTGAATGCCT pLX_317 29.1% 87.7% 87.6% V5 1_177del;676G>T n/a
4 ccsbBroadEn_08292 pDONR223 100% 87.7% 87.8% None 1_177del;816C>T n/a
5 ccsbBroad304_08292 pLX_304 0% 87.7% 87.8% V5 1_177del;816C>T n/a
6 ccsbBroadEn_15068 pDONR223 0% 87.7% 87.8% None 1_177del;816C>T n/a
7 ccsbBroad304_15068 pLX_304 0% 87.7% 87.8% V5 1_177del;816C>T n/a
8 TRCN0000469002 TCGCCTTGAGGCGCCCCCCTGCCA pLX_317 30.3% 87.7% 87.8% V5 1_177del;816C>T n/a
9 TRCN0000465932 GCCTATCAGACCGAAGTTGTCGTT pLX_317 100% 17.9% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_15841 pDONR223 0% 17.5% 14.5% None (many diffs) n/a
11 ccsbBroad304_15841 pLX_304 0% 17.5% 14.5% V5 (many diffs) n/a
12 ccsbBroadEn_15842 pDONR223 0% 14.3% 14.2% None (many diffs) n/a
13 ccsbBroad304_15842 pLX_304 0% 14.3% 14.2% V5 (many diffs) n/a
14 TRCN0000492194 ATCCTCCCCCCGGAGATAATCTAT pLX_317 100% 14.3% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV