Construct: ORF TRCN0000478702
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008390.2_s317c1
- Derived from:
- ccsbBroadEn_01442
- DNA Barcode:
- TGACTCGCGTTGCAACCAATCGTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- RPLP2 (6181)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478702
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6181 | RPLP2 | ribosomal protein lateral s... | NM_001004.4 | 100% | 100% | |
| 2 | mouse | 67186 | Rplp2 | ribosomal protein, large P2 | NM_026020.6 | 89.8% | 99.1% | (many diffs) |
| 3 | mouse | 67186 | Rplp2 | ribosomal protein, large P2 | XM_006536229.1 | 89.8% | 99.1% | (many diffs) |
| 4 | mouse | 665931 | Rplp2-ps1 | ribosomal protein, large P2... | NR_038063.1 | 37.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 411
- ORF length:
- 345
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttgcgatgcg ctacgtcgcc tcctacctgc tggctgccct agggggcaac tcctccccca 121 gcgccaagga catcaagaag atcttggaca gcgtgggtat cgaggcggac gacgaccggc 181 tcaacaaggt tatcagtgag ctgaatggaa aaaacattga agacgtcatt gcccagggta 241 ttggcaagct tgccagtgta cctgctggtg gggctgtagc cgtctctgct gccccaggct 301 ctgcagcccc tgctgctggt tctgcccctg ctgcagcaga ggagaagaaa gatgagaaga 361 aggaggagtc TGAAGAGTCA GATGATGACA TGGGATTTGG CCTTTTTGAT TAAATTCCTG 421 CTCCCCTGCA AATAAAGCCT TTTTACACAT CTCAAAAAAA AAAAAAAAAA ACTCGAGGCA 481 TCTATGTCGG GTGCGGAGAA AGAGGTAATG AAATGGCACA TGGTCATAGC TGTTTCCTGA 541 CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG 601 TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT 661 TTATATATCT TGTGGAAAGG ACGATGACTC GCGTTGCAAC CAATCGTGAC GCGTTAAGTC 721 gacaatcaac ctctggatta caaaatttgt gaaagatt