Transcript: Human NM_001004.4

Homo sapiens ribosomal protein lateral stalk subunit P2 (RPLP2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RPLP2 (6181)
Length:
462
CDS:
75..422

Additional Resources:

NCBI RefSeq record:
NM_001004.4
NBCI Gene record:
RPLP2 (6181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429324 ATTGAAGACGTCATTGCCCAG pLKO_005 225 CDS 100% 1.200 1.680 N RPLP2 n/a
2 TRCN0000435245 CAGATGATGACATGGGATTTG pLKO_005 388 CDS 100% 10.800 7.560 N RPLP2 n/a
3 TRCN0000431880 GACCGGCTCAACAAGGTTATC pLKO_005 183 CDS 100% 10.800 7.560 N RPLP2 n/a
4 TRCN0000117708 CGCCAAGGACATCAAGAAGAT pLKO.1 131 CDS 100% 4.950 3.465 N RPLP2 n/a
5 TRCN0000117711 CAAGGTTATCAGTGAGCTGAA pLKO.1 194 CDS 100% 4.050 2.835 N RPLP2 n/a
6 TRCN0000117709 GATCTTGGACAGCGTGGGTAT pLKO.1 149 CDS 100% 4.050 2.835 N RPLP2 n/a
7 TRCN0000117707 GCCCAGGGTATTGGCAAGCTT pLKO.1 240 CDS 100% 1.000 0.700 N RPLP2 n/a
8 TRCN0000117710 ATTGGCAAGCTTGCCAGTGTA pLKO.1 249 CDS 100% 0.495 0.347 N RPLP2 n/a
9 TRCN0000413464 GCCAGTGTACCTGCTGGTGGG pLKO_005 261 CDS 100% 0.000 0.000 N RPLP2 n/a
10 TRCN0000412431 GCTGTAGCCGTCTCTGCTGCC pLKO_005 282 CDS 100% 0.000 0.000 N RPLP2 n/a
11 TRCN0000415966 GTATCGAGGCGGACGACGACC pLKO_005 166 CDS 100% 0.000 0.000 N RPLP2 n/a
12 TRCN0000419506 AGAGGAGAAGAAAGATGAGAA pLKO_005 347 CDS 100% 4.950 2.970 N RPLP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01442 pDONR223 96.4% 100% 100% None n/a
2 ccsbBroad304_01442 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000466748 CGACCCGGGCCCTGACTTCGTGAG pLX_317 34.6% 100% 100% V5 (not translated due to prior stop codon) n/a
4 TRCN0000478702 TGACTCGCGTTGCAACCAATCGTG pLX_317 36.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV